ID: 1127653948 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:61037793-61037815 |
| Sequence | CTATAATAGAAGATGGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 410 | |||
| Summary | {0: 1, 1: 1, 2: 4, 3: 29, 4: 375} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127653946_1127653948 | -10 | Left | 1127653946 | 15:61037780-61037802 | CCTGAGATGAATGCTATAATAGA | 0: 1 1: 0 2: 0 3: 7 4: 144 |
||
| Right | 1127653948 | 15:61037793-61037815 | CTATAATAGAAGATGGAAGAAGG | 0: 1 1: 1 2: 4 3: 29 4: 375 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127653948 | Original CRISPR | CTATAATAGAAGATGGAAGA AGG | Intronic | ||