ID: 1119672781 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:76532099-76532121 |
Sequence | TTGTAATATTAGTGGGAAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1119672781_1119672785 | 4 | Left | 1119672781 | 14:76532099-76532121 | CCCTCTTCCCACTAATATTACAA | No data | ||
Right | 1119672785 | 14:76532126-76532148 | GTTAGAATAAAAAAGCATTATGG | No data | ||||
1119672781_1119672786 | 12 | Left | 1119672781 | 14:76532099-76532121 | CCCTCTTCCCACTAATATTACAA | No data | ||
Right | 1119672786 | 14:76532134-76532156 | AAAAAAGCATTATGGTTTCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1119672781 | Original CRISPR | TTGTAATATTAGTGGGAAGA GGG (reversed) | Intergenic | ||