ID: 1116767604 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:49091683-49091705 |
| Sequence | CTGAAGGAGTAGAGGCAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116767604_1116767606 | -10 | Left | 1116767604 | 14:49091683-49091705 | CCTTCTTGCCTCTACTCCTTCAG | No data | ||
| Right | 1116767606 | 14:49091696-49091718 | ACTCCTTCAGAGACTGTAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116767604 | Original CRISPR | CTGAAGGAGTAGAGGCAAGA AGG (reversed) | Intergenic | ||