ID: 1113202545 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:107883071-107883093 |
| Sequence | CTGTATTTGTAGAGGGGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 535 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 30, 4: 503} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1113202545_1113202551 | 8 | Left | 1113202545 | 13:107883071-107883093 | CCCTCTCCCCTCTACAAATACAG | 0: 1 1: 0 2: 1 3: 30 4: 503 |
||
| Right | 1113202551 | 13:107883102-107883124 | TGTAAAGTAGGTCTATTTATTGG | No data | ||||
| 1113202545_1113202550 | -4 | Left | 1113202545 | 13:107883071-107883093 | CCCTCTCCCCTCTACAAATACAG | 0: 1 1: 0 2: 1 3: 30 4: 503 |
||
| Right | 1113202550 | 13:107883090-107883112 | ACAGACAATCTCTGTAAAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1113202545 | Original CRISPR | CTGTATTTGTAGAGGGGAGA GGG (reversed) | Intergenic | ||