ID: 1106900583 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:34351269-34351291 |
Sequence | ATGGATGAGTAGAGGGATGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1106900583 | Original CRISPR | ATGGATGAGTAGAGGGATGA TGG | Intergenic | ||