ID: 1106713550

View in Genome Browser
Species Human (GRCh38)
Location 13:32364514-32364536
Sequence CTGTATTAGTAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106713550 Original CRISPR CTGTATTAGTAGAGGGAAGA TGG (reversed) Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902162195 1:14540021-14540043 CTGTATTACTAGGGGAGAGAGGG + Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
910724297 1:90322498-90322520 ATGGATTGGTAGAGAGAAGATGG + Intergenic
910787419 1:91015474-91015496 GACTATTAGTAGAGAGAAGAAGG - Intronic
915431410 1:155869693-155869715 TTGTATTAGAAGAGGGACGAGGG + Intronic
916477600 1:165185255-165185277 CTGAATTAGTTGAGGGCAGTAGG - Intergenic
919418435 1:197340835-197340857 CTTTATTAGCAGAGTGAAAATGG - Intronic
921862715 1:220056012-220056034 CTCCATTCGTAGAGGGAAGCAGG + Intergenic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
923509720 1:234639844-234639866 GTGTATTATGAGTGGGAAGAAGG + Intergenic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1073832574 10:107402807-107402829 CTCTATTTGTAAGGGGAAGAAGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075550988 10:123392079-123392101 CTATACTAGAAGATGGAAGAAGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1077368310 11:2170200-2170222 CTGGATTAGTGATGGGAAGAGGG + Intronic
1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG + Intronic
1078012556 11:7584110-7584132 CTGTAGTATTACAGGGAATAAGG - Intronic
1079663973 11:23080575-23080597 CTGTACTAGTACATGGCAGAGGG + Intergenic
1080009694 11:27445550-27445572 CTGTATTCGTTGGGGGAGGAGGG - Intronic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1087063170 11:94002638-94002660 CTTTAATGGTAGAAGGAAGAAGG + Intergenic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1089066969 11:115669618-115669640 CTGTAATAGTCTAGGAAAGAGGG + Intergenic
1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091096859 11:132831532-132831554 ATGTCTAAGTAGAGGGAAAATGG - Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG + Intergenic
1096889449 12:54752997-54753019 CTATATTAGTAGTGGGAGAAGGG + Intergenic
1098856823 12:75662466-75662488 CTGTATTAGCAGTGTGAAAATGG - Intergenic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106900583 13:34351269-34351291 ATGGATGAGTAGAGGGATGATGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107645024 13:42485278-42485300 ATGTATTATTACAGAGAAGAAGG - Intergenic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1109835562 13:67852073-67852095 CTATAGTAGTAGTGGGAAGTGGG + Intergenic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1125182500 15:36893745-36893767 CTGCATTAGTAAAGGAAGGAAGG + Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1138361295 16:56430598-56430620 CAGTATTAGAAGAGGGTATAAGG - Exonic
1140800873 16:78487368-78487390 TTGTATTAGTAGATGGGATACGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1149079382 17:52635426-52635448 GTGGATTACTAGAGGGGAGAGGG + Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1153388106 18:4522575-4522597 CTTTTTTAGTAGAGTGATGAGGG + Intergenic
1156735411 18:40252182-40252204 CTCTATCAATAGAGAGAAGAAGG - Intergenic
1157182256 18:45508231-45508253 CTCTATTAGTATTTGGAAGAGGG + Intronic
1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG + Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
930044199 2:47154891-47154913 TTTAATTAGTAGTGGGAAGAAGG + Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930803788 2:55469875-55469897 CTGTATTAGTAGAATGAAATGGG + Intergenic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931285869 2:60831054-60831076 CTGTATTAGTAAAGTTGAGAGGG - Intergenic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
938122874 2:128645958-128645980 ATGAATGAGTAGAGGGAACAAGG - Intergenic
938235517 2:129703192-129703214 CTGTATTAGCAGTGTGAAAATGG - Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942141462 2:172981318-172981340 CTATAGTAGTAGATGGATGAAGG + Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945127076 2:206524494-206524516 CTTTATTAGCAGAGTGAAAATGG - Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
1168733542 20:109447-109469 GTGGATTACTAGAGGGAGGAGGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG + Intronic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1185086303 22:48742771-48742793 GTGTATTAGAAGAGGAGAGATGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950943157 3:16915103-16915125 CTGTCTTAGTAGACGGATGTTGG + Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951090051 3:18561889-18561911 CTGTAATAGTTGAGTCAAGAAGG - Intergenic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG + Intergenic
964265736 3:154893484-154893506 CTGTCTTATTAGAGGGCAGGTGG - Intergenic
964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG + Intergenic
964895364 3:161589707-161589729 CTTTATTAGTAGAGTGAGAATGG - Intergenic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
964969817 3:162545727-162545749 CTTTATTAATAGTGGGTAGAAGG - Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967343741 3:188429660-188429682 CTCTATTATGAAAGGGAAGACGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
972043237 4:34630682-34630704 CTGTATTTGAAGTTGGAAGAAGG - Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977932633 4:102765154-102765176 GCGTATTAGTAGATGGAACACGG + Intergenic
979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG + Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
988400136 5:30751608-30751630 CTGTATTACTAGATGAAACAGGG - Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1001144902 5:169175356-169175378 GTGTACTAGGAGTGGGAAGAGGG - Intronic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005214847 6:23513322-23513344 CTGTATTGGTATAGGGAGGGGGG - Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1012187181 6:96233395-96233417 CTGGATTAGAAGAAGGTAGATGG - Intergenic
1013547785 6:111176168-111176190 GTGGATTAGTAGAGGGAGAAGGG + Intronic
1015532920 6:134239257-134239279 GTGTATTATCAGAGGGAAGTGGG - Intronic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016585697 6:145682037-145682059 CTTTATTAGCAGAGTGAAAACGG - Intronic
1017409042 6:154149836-154149858 CTGGAATAGTAGAGGCCAGATGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1018343396 6:162876319-162876341 CTGTATTATTAGAGGACAGCAGG - Intronic
1018549716 6:164981782-164981804 CTGTGTTTGTACAGGGTAGAAGG - Intergenic
1018673120 6:166195778-166195800 CTGGAATAGTAGAGGGAATGCGG + Intergenic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG + Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG + Intergenic
1031490612 7:122383320-122383342 GTGGACTAGTAGAGGGGAGAGGG + Intronic
1031552475 7:123132224-123132246 TTTTATTAGTAGTGAGAAGATGG - Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1033564497 7:142565437-142565459 CTGGATTAGTAGCAGGCAGAAGG - Intergenic
1033568597 7:142604615-142604637 ATGTATTAGTAGATGAATGAGGG - Intergenic
1033990800 7:147283939-147283961 GTATCTTAGTAAAGGGAAGATGG - Intronic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1038555020 8:28505176-28505198 CTGGATCAGTAGAGGGATGGAGG - Intronic
1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG + Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042497412 8:69470645-69470667 CTGCAGTAGTAGACAGAAGAGGG - Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046508772 8:115171938-115171960 CTTTATTAGTAGTGTGAGGATGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1051877252 9:21805688-21805710 CTCACTTAGTAGAGGGAATAAGG - Intronic
1052578080 9:30316401-30316423 ATTAATTAGTAGAGGGAACATGG - Intergenic
1055680568 9:78710937-78710959 CTGTATCAGTAGAGTTAAGATGG + Intergenic
1056327936 9:85496165-85496187 GTGTGTTAGTAGGGGGAAGGAGG - Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057400595 9:94719905-94719927 TTCTATTACTAGGGGGAAGAGGG + Intergenic
1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG + Intronic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1194237631 X:91403888-91403910 GTGTACTACTAGAGGGGAGAGGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG + Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic