ID: 1104908468 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:132228192-132228214 |
| Sequence | CTGCATGAGTGGAGGGCAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 359 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 24, 4: 331} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1104908468_1104908474 | 6 | Left | 1104908468 | 12:132228192-132228214 | CCCTCTGCCCTCCACTCATGCAG | 0: 1 1: 0 2: 3 3: 24 4: 331 |
||
| Right | 1104908474 | 12:132228221-132228243 | GACACCCCCGCGTCCCTCCCCGG | 0: 1 1: 0 2: 3 3: 56 4: 268 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1104908468 | Original CRISPR | CTGCATGAGTGGAGGGCAGA GGG (reversed) | Intronic | ||