ID: 1104236120 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:126938075-126938097 |
Sequence | CTGTAATAGCAGAGAGGAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104236113_1104236120 | 17 | Left | 1104236113 | 12:126938035-126938057 | CCATGCCCAACATCACTAGGAAA | No data | ||
Right | 1104236120 | 12:126938075-126938097 | CTGTAATAGCAGAGAGGAGAAGG | No data | ||||
1104236115_1104236120 | 11 | Left | 1104236115 | 12:126938041-126938063 | CCAACATCACTAGGAAAGAAAGC | No data | ||
Right | 1104236120 | 12:126938075-126938097 | CTGTAATAGCAGAGAGGAGAAGG | No data | ||||
1104236114_1104236120 | 12 | Left | 1104236114 | 12:126938040-126938062 | CCCAACATCACTAGGAAAGAAAG | No data | ||
Right | 1104236120 | 12:126938075-126938097 | CTGTAATAGCAGAGAGGAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104236120 | Original CRISPR | CTGTAATAGCAGAGAGGAGA AGG | Intergenic | ||