ID: 1101197911 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:102404510-102404532 |
Sequence | CTGACTGAGTAGAAGGAAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 407 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 28, 4: 375} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1101197908_1101197911 | 28 | Left | 1101197908 | 12:102404459-102404481 | CCTTCATGAAAGGTAGCTAGTGT | 0: 1 1: 0 2: 1 3: 8 4: 113 |
||
Right | 1101197911 | 12:102404510-102404532 | CTGACTGAGTAGAAGGAAGATGG | 0: 1 1: 0 2: 3 3: 28 4: 375 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1101197911 | Original CRISPR | CTGACTGAGTAGAAGGAAGA TGG | Intronic | ||