ID: 1096889449 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:54752997-54753019 |
Sequence | CTATATTAGTAGTGGGAGAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1096889445_1096889449 | 17 | Left | 1096889445 | 12:54752957-54752979 | CCTTCTGACTAAAGATGGACATC | No data | ||
Right | 1096889449 | 12:54752997-54753019 | CTATATTAGTAGTGGGAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1096889449 | Original CRISPR | CTATATTAGTAGTGGGAGAA GGG | Intergenic | ||