ID: 1095833549 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:46613063-46613085 |
Sequence | CAGGGTTAGTAGAGGGAACA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1095833549_1095833557 | 17 | Left | 1095833549 | 12:46613063-46613085 | CCATGTTCCCTCTACTAACCCTG | No data | ||
Right | 1095833557 | 12:46613103-46613125 | CCAAATCTCAGTGAACATAACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1095833549 | Original CRISPR | CAGGGTTAGTAGAGGGAACA TGG (reversed) | Intergenic | ||