ID: 1092071591 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:5635942-5635964 |
| Sequence | CTTGATAAGTAGAGGCAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 248 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 230} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1092071589_1092071591 | 4 | Left | 1092071589 | 12:5635915-5635937 | CCTGAGCTGAGAAGGGATGAGTT | 0: 1 1: 0 2: 0 3: 15 4: 185 |
||
| Right | 1092071591 | 12:5635942-5635964 | CTTGATAAGTAGAGGCAAGAAGG | 0: 1 1: 0 2: 1 3: 16 4: 230 |
||||
| 1092071586_1092071591 | 16 | Left | 1092071586 | 12:5635903-5635925 | CCATTGAAGGTACCTGAGCTGAG | 0: 1 1: 0 2: 0 3: 18 4: 146 |
||
| Right | 1092071591 | 12:5635942-5635964 | CTTGATAAGTAGAGGCAAGAAGG | 0: 1 1: 0 2: 1 3: 16 4: 230 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1092071591 | Original CRISPR | CTTGATAAGTAGAGGCAAGA AGG | Intronic | ||