ID: 1091096859

View in Genome Browser
Species Human (GRCh38)
Location 11:132831532-132831554
Sequence ATGTCTAAGTAGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091096859 Original CRISPR ATGTCTAAGTAGAGGGAAAA TGG (reversed) Intronic