ID: 1089066969 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:115669618-115669640 |
| Sequence | CTGTAATAGTCTAGGAAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1089066965_1089066969 | 0 | Left | 1089066965 | 11:115669595-115669617 | CCTGGGTGTTAGTTAGGAGCCTA | No data | ||
| Right | 1089066969 | 11:115669618-115669640 | CTGTAATAGTCTAGGAAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1089066969 | Original CRISPR | CTGTAATAGTCTAGGAAAGA GGG | Intergenic | ||