ID: 1087063170 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:94002638-94002660 |
Sequence | CTTTAATGGTAGAAGGAAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087063167_1087063170 | 16 | Left | 1087063167 | 11:94002599-94002621 | CCATGCTGAAAGCTCTAGGCTTA | No data | ||
Right | 1087063170 | 11:94002638-94002660 | CTTTAATGGTAGAAGGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087063170 | Original CRISPR | CTTTAATGGTAGAAGGAAGA AGG | Intergenic | ||