ID: 1080009694 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:27445550-27445572 |
| Sequence | CTGTATTCGTTGGGGGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 184 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 174} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1080009694_1080009701 | 3 | Left | 1080009694 | 11:27445550-27445572 | CCCTCCTCCCCCAACGAATACAG | 0: 1 1: 0 2: 0 3: 9 4: 174 |
||
| Right | 1080009701 | 11:27445576-27445598 | CACACTTAGAAGTACAATAGAGG | 0: 1 1: 0 2: 0 3: 8 4: 117 |
||||
| 1080009694_1080009702 | 7 | Left | 1080009694 | 11:27445550-27445572 | CCCTCCTCCCCCAACGAATACAG | 0: 1 1: 0 2: 0 3: 9 4: 174 |
||
| Right | 1080009702 | 11:27445580-27445602 | CTTAGAAGTACAATAGAGGCTGG | 0: 1 1: 0 2: 1 3: 20 4: 155 |
||||
| 1080009694_1080009703 | 16 | Left | 1080009694 | 11:27445550-27445572 | CCCTCCTCCCCCAACGAATACAG | 0: 1 1: 0 2: 0 3: 9 4: 174 |
||
| Right | 1080009703 | 11:27445589-27445611 | ACAATAGAGGCTGGTTTCAGTGG | 0: 1 1: 0 2: 6 3: 33 4: 675 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1080009694 | Original CRISPR | CTGTATTCGTTGGGGGAGGA GGG (reversed) | Intronic | ||