ID: 1078012556 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:7584110-7584132 |
| Sequence | CTGTAGTATTACAGGGAATA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 236 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 20, 4: 215} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1078012556_1078012561 | -6 | Left | 1078012556 | 11:7584110-7584132 | CCTTATTCCCTGTAATACTACAG | 0: 1 1: 0 2: 0 3: 20 4: 215 |
||
| Right | 1078012561 | 11:7584127-7584149 | CTACAGAGCTTTTTAAGGGCAGG | 0: 1 1: 0 2: 0 3: 15 4: 150 |
||||
| 1078012556_1078012562 | -5 | Left | 1078012556 | 11:7584110-7584132 | CCTTATTCCCTGTAATACTACAG | 0: 1 1: 0 2: 0 3: 20 4: 215 |
||
| Right | 1078012562 | 11:7584128-7584150 | TACAGAGCTTTTTAAGGGCAGGG | 0: 1 1: 0 2: 2 3: 25 4: 259 |
||||
| 1078012556_1078012563 | 24 | Left | 1078012556 | 11:7584110-7584132 | CCTTATTCCCTGTAATACTACAG | 0: 1 1: 0 2: 0 3: 20 4: 215 |
||
| Right | 1078012563 | 11:7584157-7584179 | TCATTGTTTAGCACAGAAAGTGG | 0: 1 1: 1 2: 1 3: 19 4: 264 |
||||
| 1078012556_1078012560 | -10 | Left | 1078012556 | 11:7584110-7584132 | CCTTATTCCCTGTAATACTACAG | 0: 1 1: 0 2: 0 3: 20 4: 215 |
||
| Right | 1078012560 | 11:7584123-7584145 | AATACTACAGAGCTTTTTAAGGG | 0: 1 1: 0 2: 2 3: 33 4: 401 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1078012556 | Original CRISPR | CTGTAGTATTACAGGGAATA AGG (reversed) | Intronic | ||