ID: 1077368310 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:2170200-2170222 |
Sequence | CTGGATTAGTGATGGGAAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 295 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 29, 4: 264} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1077368304_1077368310 | -6 | Left | 1077368304 | 11:2170183-2170205 | CCCAGGCCAGGCGCTAACTGGAT | 0: 1 1: 0 2: 1 3: 6 4: 57 |
||
Right | 1077368310 | 11:2170200-2170222 | CTGGATTAGTGATGGGAAGAGGG | 0: 1 1: 0 2: 1 3: 29 4: 264 |
||||
1077368305_1077368310 | -7 | Left | 1077368305 | 11:2170184-2170206 | CCAGGCCAGGCGCTAACTGGATT | 0: 1 1: 0 2: 0 3: 6 4: 52 |
||
Right | 1077368310 | 11:2170200-2170222 | CTGGATTAGTGATGGGAAGAGGG | 0: 1 1: 0 2: 1 3: 29 4: 264 |
||||
1077368303_1077368310 | -5 | Left | 1077368303 | 11:2170182-2170204 | CCCCAGGCCAGGCGCTAACTGGA | 0: 1 1: 0 2: 0 3: 5 4: 113 |
||
Right | 1077368310 | 11:2170200-2170222 | CTGGATTAGTGATGGGAAGAGGG | 0: 1 1: 0 2: 1 3: 29 4: 264 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1077368310 | Original CRISPR | CTGGATTAGTGATGGGAAGA GGG | Intronic | ||