ID: 1074761135 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:116668322-116668344 |
Sequence | CTCTGTTAGTGGAGGGAAGA GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 449 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 30, 4: 416} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1074761130_1074761135 | -10 | Left | 1074761130 | 10:116668309-116668331 | CCATGATTTCGCTCTCTGTTAGT | 0: 1 1: 1 2: 317 3: 85 4: 151 |
||
Right | 1074761135 | 10:116668322-116668344 | CTCTGTTAGTGGAGGGAAGAGGG | 0: 1 1: 0 2: 2 3: 30 4: 416 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1074761135 | Original CRISPR | CTCTGTTAGTGGAGGGAAGA GGG | Exonic | ||