ID: 1066055952

View in Genome Browser
Species Human (GRCh38)
Location 10:31680203-31680225
Sequence GTGTATGACCAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066055947_1066055952 0 Left 1066055947 10:31680180-31680202 CCCTTGGAACATTGATGCATATT No data
Right 1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG No data
1066055945_1066055952 24 Left 1066055945 10:31680156-31680178 CCAAGGGTCTGGCACTTATTGAA No data
Right 1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG No data
1066055948_1066055952 -1 Left 1066055948 10:31680181-31680203 CCTTGGAACATTGATGCATATTG No data
Right 1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066055952 Original CRISPR GTGTATGACCAGAGGGAAGA GGG Intergenic