ID: 1057400595 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:94719905-94719927 |
| Sequence | TTCTATTACTAGGGGGAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1057400589_1057400595 | -9 | Left | 1057400589 | 9:94719891-94719913 | CCACAAAATCAGCATTCTATTAC | No data | ||
| Right | 1057400595 | 9:94719905-94719927 | TTCTATTACTAGGGGGAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1057400595 | Original CRISPR | TTCTATTACTAGGGGGAAGA GGG | Intergenic | ||