ID: 1051877252 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:21805688-21805710 |
| Sequence | CTCACTTAGTAGAGGGAATA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051877252_1051877256 | 5 | Left | 1051877252 | 9:21805688-21805710 | CCTTATTCCCTCTACTAAGTGAG | No data | ||
| Right | 1051877256 | 9:21805716-21805738 | ACCATCTATGAGCCAAAACGTGG | No data | ||||
| 1051877252_1051877258 | 6 | Left | 1051877252 | 9:21805688-21805710 | CCTTATTCCCTCTACTAAGTGAG | No data | ||
| Right | 1051877258 | 9:21805717-21805739 | CCATCTATGAGCCAAAACGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051877252 | Original CRISPR | CTCACTTAGTAGAGGGAATA AGG (reversed) | Intronic | ||