ID: 1045398463 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:101785637-101785659 |
| Sequence | CTGGGTTAGTACAGGGAAGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045398455_1045398463 | 23 | Left | 1045398455 | 8:101785591-101785613 | CCATTAAGATTGGGGGCTATTTA | No data | ||
| Right | 1045398463 | 8:101785637-101785659 | CTGGGTTAGTACAGGGAAGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045398463 | Original CRISPR | CTGGGTTAGTACAGGGAAGA CGG | Intronic | ||