ID: 1045203191 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:100008570-100008592 |
| Sequence | CTGAAGGAGAAGAGGGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1582 | |||
| Summary | {0: 1, 1: 1, 2: 10, 3: 151, 4: 1419} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045203185_1045203191 | 24 | Left | 1045203185 | 8:100008523-100008545 | CCAATGTCAAGAGTGGCAGAAGG | 0: 1 1: 1 2: 0 3: 11 4: 146 |
||
| Right | 1045203191 | 8:100008570-100008592 | CTGAAGGAGAAGAGGGAAGAAGG | 0: 1 1: 1 2: 10 3: 151 4: 1419 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045203191 | Original CRISPR | CTGAAGGAGAAGAGGGAAGA AGG | Intronic | ||