ID: 1041858865 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:62488323-62488345 |
| Sequence | CAGAATTAGCAGAGGAAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041858865_1041858868 | -8 | Left | 1041858865 | 8:62488323-62488345 | CCTTCTTTCCTCTGCTAATTCTG | No data | ||
| Right | 1041858868 | 8:62488338-62488360 | TAATTCTGGCCTATCCATCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041858865 | Original CRISPR | CAGAATTAGCAGAGGAAAGA AGG (reversed) | Intronic | ||