ID: 1038555020 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:28505176-28505198 |
| Sequence | CTGGATCAGTAGAGGGATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1038555020_1038555028 | 6 | Left | 1038555020 | 8:28505176-28505198 | CCTCCATCCCTCTACTGATCCAG | No data | ||
| Right | 1038555028 | 8:28505205-28505227 | GCTTAGCAGGCACAAGTAATTGG | No data | ||||
| 1038555020_1038555025 | -7 | Left | 1038555020 | 8:28505176-28505198 | CCTCCATCCCTCTACTGATCCAG | No data | ||
| Right | 1038555025 | 8:28505192-28505214 | GATCCAGGAACCAGCTTAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1038555020 | Original CRISPR | CTGGATCAGTAGAGGGATGG AGG (reversed) | Intronic | ||