ID: 1033568597 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:142604615-142604637 |
| Sequence | ATGTATTAGTAGATGAATGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033568597_1033568599 | 5 | Left | 1033568597 | 7:142604615-142604637 | CCCTCATTCATCTACTAATACAT | No data | ||
| Right | 1033568599 | 7:142604643-142604665 | TCACCACATGCCAGTGACAACGG | No data | ||||
| 1033568597_1033568600 | 6 | Left | 1033568597 | 7:142604615-142604637 | CCCTCATTCATCTACTAATACAT | No data | ||
| Right | 1033568600 | 7:142604644-142604666 | CACCACATGCCAGTGACAACGGG | No data | ||||
| 1033568597_1033568601 | 7 | Left | 1033568597 | 7:142604615-142604637 | CCCTCATTCATCTACTAATACAT | No data | ||
| Right | 1033568601 | 7:142604645-142604667 | ACCACATGCCAGTGACAACGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033568597 | Original CRISPR | ATGTATTAGTAGATGAATGA GGG (reversed) | Intergenic | ||