ID: 1033564497 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:142565437-142565459 |
| Sequence | CTGGATTAGTAGCAGGCAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 191 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 178} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033564497_1033564500 | 28 | Left | 1033564497 | 7:142565437-142565459 | CCTTCTGCCTGCTACTAATCCAG | 0: 1 1: 0 2: 0 3: 12 4: 178 |
||
| Right | 1033564500 | 7:142565488-142565510 | AGACAATTTATTCACTCGCGAGG | 0: 1 1: 0 2: 0 3: 2 4: 49 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033564497 | Original CRISPR | CTGGATTAGTAGCAGGCAGA AGG (reversed) | Intergenic | ||