ID: 1033425070 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:141236534-141236556 |
Sequence | CTGCAATATTTGAGGGAAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 264 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 28, 4: 235} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1033425070_1033425074 | -9 | Left | 1033425070 | 7:141236534-141236556 | CCATCTTCCCTCAAATATTGCAG | 0: 1 1: 0 2: 0 3: 28 4: 235 |
||
Right | 1033425074 | 7:141236548-141236570 | ATATTGCAGGCCATTTGAAAAGG | No data | ||||
1033425070_1033425077 | 15 | Left | 1033425070 | 7:141236534-141236556 | CCATCTTCCCTCAAATATTGCAG | 0: 1 1: 0 2: 0 3: 28 4: 235 |
||
Right | 1033425077 | 7:141236572-141236594 | TCACCTCTATCTTCACTCCAGGG | No data | ||||
1033425070_1033425076 | 14 | Left | 1033425070 | 7:141236534-141236556 | CCATCTTCCCTCAAATATTGCAG | 0: 1 1: 0 2: 0 3: 28 4: 235 |
||
Right | 1033425076 | 7:141236571-141236593 | ATCACCTCTATCTTCACTCCAGG | 0: 1 1: 0 2: 1 3: 13 4: 138 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1033425070 | Original CRISPR | CTGCAATATTTGAGGGAAGA TGG (reversed) | Intronic | ||