ID: 1018549716 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:164981782-164981804 |
| Sequence | CTGTGTTTGTACAGGGTAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018549716_1018549721 | 10 | Left | 1018549716 | 6:164981782-164981804 | CCTTCTACCCTGTACAAACACAG | No data | ||
| Right | 1018549721 | 6:164981815-164981837 | TCATCTATGATCCAGGAGAAAGG | No data | ||||
| 1018549716_1018549720 | 3 | Left | 1018549716 | 6:164981782-164981804 | CCTTCTACCCTGTACAAACACAG | No data | ||
| Right | 1018549720 | 6:164981808-164981830 | GAAGGTGTCATCTATGATCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018549716 | Original CRISPR | CTGTGTTTGTACAGGGTAGA AGG (reversed) | Intergenic | ||