ID: 1018343396 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:162876319-162876341 |
| Sequence | CTGTATTATTAGAGGACAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 205 | |||
| Summary | {0: 1, 1: 1, 2: 2, 3: 17, 4: 184} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018343396_1018343400 | 9 | Left | 1018343396 | 6:162876319-162876341 | CCTGCTGTCCTCTAATAATACAG | 0: 1 1: 1 2: 2 3: 17 4: 184 |
||
| Right | 1018343400 | 6:162876351-162876373 | TGGCATCAGCAACTGCCAGCAGG | 0: 1 1: 0 2: 1 3: 17 4: 206 |
||||
| 1018343396_1018343401 | 17 | Left | 1018343396 | 6:162876319-162876341 | CCTGCTGTCCTCTAATAATACAG | 0: 1 1: 1 2: 2 3: 17 4: 184 |
||
| Right | 1018343401 | 6:162876359-162876381 | GCAACTGCCAGCAGGATCCCTGG | 0: 1 1: 0 2: 1 3: 20 4: 184 |
||||
| 1018343396_1018343402 | 18 | Left | 1018343396 | 6:162876319-162876341 | CCTGCTGTCCTCTAATAATACAG | 0: 1 1: 1 2: 2 3: 17 4: 184 |
||
| Right | 1018343402 | 6:162876360-162876382 | CAACTGCCAGCAGGATCCCTGGG | 0: 1 1: 0 2: 0 3: 16 4: 176 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018343396 | Original CRISPR | CTGTATTATTAGAGGACAGC AGG (reversed) | Intronic | ||