ID: 1017912803

View in Genome Browser
Species Human (GRCh38)
Location 6:158808758-158808780
Sequence CAGGATAAATAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 620}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017912803 Original CRISPR CAGGATAAATAGAGGGAAGA AGG (reversed) Intronic