ID: 1001203364 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:169739301-169739323 |
Sequence | CTGTAATTGTAGAGGGAAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 349 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 24, 4: 323} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1001203361_1001203364 | 17 | Left | 1001203361 | 5:169739261-169739283 | CCAGAAACTGGGAGGCAGGTGAA | No data | ||
Right | 1001203364 | 5:169739301-169739323 | CTGTAATTGTAGAGGGAAAATGG | 0: 1 1: 0 2: 1 3: 24 4: 323 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1001203364 | Original CRISPR | CTGTAATTGTAGAGGGAAAA TGG | Intronic | ||