ID: 1000707172 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:164526327-164526349 |
Sequence | CTGTGATAGCAGAGTGAAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1000707172 | Original CRISPR | CTGTGATAGCAGAGTGAAGA GGG (reversed) | Intergenic | ||