ID: 1000427693 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:161112030-161112052 |
Sequence | CTGTATGAGTAGGGGTAAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1000427693_1000427697 | -2 | Left | 1000427693 | 5:161112030-161112052 | CCTTCTTACCCCTACTCATACAG | No data | ||
Right | 1000427697 | 5:161112051-161112073 | AGATGAACTACACTGACTCTAGG | No data | ||||
1000427693_1000427699 | 3 | Left | 1000427693 | 5:161112030-161112052 | CCTTCTTACCCCTACTCATACAG | No data | ||
Right | 1000427699 | 5:161112056-161112078 | AACTACACTGACTCTAGGAAGGG | No data | ||||
1000427693_1000427698 | 2 | Left | 1000427693 | 5:161112030-161112052 | CCTTCTTACCCCTACTCATACAG | No data | ||
Right | 1000427698 | 5:161112055-161112077 | GAACTACACTGACTCTAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1000427693 | Original CRISPR | CTGTATGAGTAGGGGTAAGA AGG (reversed) | Intergenic | ||