High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
5' retrieval block size U block size Min 5' spacer Critical Exon Min 3' spacer D block size 3' retrieval block size
 
       
Subtype Domain Disrupted
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 353
Chr: 11
Strand: 1
Status: Ordered
BACs: bMQ247k17 : RP24-224K2 : RP24-421L6 : RP24-175O19 : RP24-536J5 : RP24-166E22 : RP24-470A12 : RP24-172L7 : RP24-462G2 :
Instance: Plate 16: Well F03: BACs bMQ247k17
Instance: Plate 6: Well F03: BACs bMQ247k17
Oligos on GRCm38:
Type Start End Length Seq
G5 5518054 5518103 50 GCAAAGTATATTTATAATTTCAAAGAGCCAATCTGAACCATCACTTAGAA
U5 5521646 5521695 50 AGAAGCATATGACGCAACGGGAATGTATCAGCCCGGTGGTAAAATGAGAT
U3 5521719 5521768 50 AGAATCAAGCAAGTCTTCAAGGCCTGTGGATAGAAAGCAGCGTGTGTATG
D5 5522179 5522228 50 CTCGGAGATTAGCCAGGTTGGATAGATCATTGGTTGCTTAAGCTGTAGCG
D3 5522299 5522348 50 CAATCCTCCCACCCTCTGTATCCTTTCTGCTGTCAGTGCCCTTTTGTGCC
G3 5525753 5525802 50 ATGAAGATCAAGAATCTTTGTAAAATGATGAAAATTTACTATGTAAATGC
Oligos:
Type Start End Length Seq
15_E_15 5401434 5432136 30703 GGTGGCTCACAACCATCCATAACAAGATCTGATGCCCTCTTCCGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATAAATCTTTAAAAAAAAAATATTTGGTTAAAAAACAAATAAAACAAACAAACAAACAAACAAAAAAAGCAGACCAAAATCCAAAAAACTCTTGGGCTATCAAGATGGCTCAGTGACTAAAATTACCTGTCACCAAGCCTGATCCATCCTCAGGTTGACCTTTAACCTCCACACTCACACCTGCCATATGTACAGAAACATGCTCTCCAGCACACGCACACGTGCGCGCACACACACAACTAATAAACAAATAAATGCGATGCATTTTTAGAAGAACATTCTCAAAGACACGATAAACCCCAGGCTAATACATTTTACTAATTTTTTTTTTTTCTGAGACAGGGTTTCACTATGCGGCCCTAGCTGTCCTTAACTCACTCTGTAGACCAGGCTAGCTTTGAACTCAGAAATCTGCCAGCCTCTGCCTCTCCAGTACTGGGACTAAAGGTGTGTGCCACCACCCCCTGGCTTTACTTATCTTTTAAATCTTATTTAATTTCAAGCTTTTCTTACTTTTTCAACCTTGTAAATTACACCATTTAAAAAATATAGCATAGAAAACTACAGGGTTGTATCTGTAGCTTATACACGGTTGTATCTGTAGCCTCTGTAAACACAGCTTAGTCTGTTTCTCCCCTGGCACTTTTTGCAAGATTAACATTCAAATTTTATTTCACAAGAGAAATGAATTTTATATAAGAATTTGTTCTTCATCCTCAGCTGGATCATTTAAGAAAGCTTGGGTATTTTACTCCTTTCTCCCTCCCTCCCCCAAAGGGTCTTGCTATGTAATTTAGGCTAGCCTCAACTTGAGACTATCCTCCTGCTTCAGACTCCTAAGTGCTAGGATTACATCTACCCATCTTTTTTTTTTTTTTTTTTTTTTGAAGATAAAGTGATTTTATTTGAATTTTTGACGACTATATCTTGTTGTATAAAGGGAAGAGTGAAAGATAAGAATTGACCATTTCAAGGCACATTACAACACTCAGTCATTTTAATTTAATTATTGTTTTGAATATTAACATGGTTGCCTCTACACTAAATGAAGGACTTAATAAAAGATTGTAATAGGAAGAAAGTTTTGCTATAAATGTTGTTCCTTGGTATCCCCTAGAATCTTAAGCAGGTAAATTTTGTACACATGGATTCGTCCTATCCTCTTAACTACAATGTTATTTTGTTTTTATTAGCAGCTGCATAGATAATTATTGGCAGTTCCCTTCCTTGCAAAGTTGTACAATATTTATTAATTCTACAGACCTTGCTAGTCTTCTCTAAAATGAAAGACAACTGTCTGGTAAAACAAGAAAGGTCCCTCAAGCTTCAAATCTGTTCGACATGACATTTCTTAGGAATGTATGCTAGGGACATATTTAAGGATAATTTAAGAGTTTCATTTAAAAACTACGAATTTAGAGTCTATTTCTAAACACATTATGAGGCCCAGTAATTCACAACTGAATAGTGGAAGAATATAATTTGTACAAAATAACTTGTAAATTTAGAACAAAATTTTACGTCTTTGATTTTAAAATACAGCAGTTAACTTTCCCTCAACTTCTATTATTTTCTTTTTTTTTATTTTTTTTACGTATTTTCCTCAATTACATTTCCAATGCTATCCCAAAAGTCCCCCACACCCTCCCCCCACCTACCCATCTTTTATTTAAGAGTGAATTTGGGGGCCAGTGAGATGACTCAGGGTAAGGCACTTGCTCCACGCCTGATCCGAGTTTGGTCCTTGGGACCCTCTATGGAATGGAAGAGCTGATGACCACAAGTTCTCTTGTGACCTCCACAGGAGTGCAAAGGTATAGCCACGTGCACACTGTATGCCTGTTCACACTCAGACACACAGAATTAATGGCTCTAAGTGTTTAAAAGTTCCAAGTTTGTGAGACGATAAAATGTCATCCCAACTTCCTCTCTACGTTTCTCTGGTTTTGGACAGATTCTTATTTCGAAGCCCAGGCTGGCCTTGAATTAATCTTTCTCCCTCAACTTCTGAAGTGTACCACTAAGTCCAGTCCTTTTCATCTTGATTGGTGTGTTTGGGTTAGTCCTCCTCAGTGTGATGGGCTTATTGTTTGCTTGTTTTGTTTATTTATTTGTTTGCTTGTTGCCGAAGTTGTGGCATTACCACAAGCAAAATGCACATGAAAATCGTGGTACGAAGCATGCTGAATTCTGTGCCCATTCTTCAGAACAATTTCTACACCTGACTAGCTGATTGTCAGGCGGATAGATGTAGGCAGGAACCAGAGGCAGCCGCTACCTTCAAGGTCTGCTCTGGGGATGACAGGTCGGTCTGAGCTATAGGAACAGCAGGTACAATCTGGAGGGATGCTTGCCTTGAGTTCAGAGCAGTGAGTCTTAGCGAGAGGCAAGGGATTTTGTAGGTAAAGACCCCAGACATGCTTTAAATACCTCGTGTGGCACAAAACATGGGATAACCTCCCCACAAAGAATTGTCTAGCGCCAAATGTCAATAATTCTGAGGTAGAAAAACTGACTTAAACAGAAAGAGGAAATGGGATTTGTGAGCATAATAAAAGGGAAGGAGGGGCTGGAAAGATGGCTCAAGCTGCCAAGGTGGCCACCACAGAAGCATGAGGATGGAGCCCTGTTCAAGTCTCCCGCACTCACATGACAAAGAGGCACACTGGCACACGCCTGCACACCCTGAGGAGGAGACAGCACTCACATGACAAAGAGGCACACTGGCACACACCTGCACACCCTGAGGAGGAGACAGGAAGATCCCTTGGTTTGCTGGTGAGCCAGGCTGGCCACAGTGACTCAGTGAAACCGTGAGTCCCCAAATAGGGTAAAGAGTGATAGGCAAGACCAGAAGCCAGTCTCTGGCCTTTGAACATACACTCCTGTATGAACACTTGAGTGCACACACGGGTGACCGCAAGCGCATGCACACACACACACAACCCATCTCACATGAGACAGGGCTGCAGCTGAGACAGGGATAAACAAGAAGAGTCATCAATGGTCCTAAGCTGATTATCTTTTAATCACTCACAAGAGTGACTCCTGCTAAGTGTCTCATCTTATCTCCTGGCATCAGAAAGCAGGCTACTGTGGCAGGACCAGCTACTTGCAGATGCTCTCTCTGCTCAGGGGTGGTTCCTCCCAGTGCTGGCAACCCATCCATGAGAGCAACAAAAGTCTCAGTGTTCAGAGAGGCCATCCCAGGCAGTGGGGAAAGCAGGGATCATGCTTTCTGATATGTCATGGGAACCCGGCTGCCCTGGTATTTACAGTTCTTGCATAACTGTGCATGTGGGAGTGCTCAGTCCTGGGTAGAAGGCCATGCTCTGAAGCCATGAGGTAGCCAGGCTCTTTCTCACATCTTTAGCATACATGAGCTTGCTTTCCTCATACTTGCAGAATGGCCACTGAGACCCTCTCCAGTTTTGGAACTAGGTCAACTTTCCAGGCAGGATGAGAGGAAAGGAAGTGAAGTCAATAGGTAAGAGGTGAAAGGCTCCCAGCGAAGTCCTCACCACTGAATAAACTTCCTGGAATCCTCTACGCCTCCGAACTTCTGCTGACACATTGGTTCAAACTGTACCACACGGCCATCTTCAGTTTCACGAGAATCTGGAAGCTGTGTGTTTTCAAGTAGGCTCTTTGAACAAAATAGACAGGAAAAAAACAGAGCAGATAGACACTCCGCAGGCTGCCAAATGAGCGTTTCCAGCCCTTCTGTGTCCACGATGAGACAGCCTGCCTCTGAGTTCTGCCTTCATGAGAATGGTGGAAGACAGTCTTCAGCATCGGACCAATGTTCTGCCATTTAAAGTCTATTGCAGGCTAGGTGTGGTGGAGCATGCTTGAAATCCCAACTGGGGGGAAAGCCAAAAGGATTGTGAATTTGAGGCCAGTAAGCCATGCTCCTCAGAGAAATGAATGAATGACAGAAAGGAAAGAGCACGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAGGGAGGGACGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAAGGAACTCTTAGGAAATCTGGCAATTCAATTGCTGTCCAAAGGTCCTGAGTGGACTTGGCAGTTGAGAGTGTGCATTGCAGGGACTCTGGCCATCCTGCACATGGTGAGCATGGCTCTGCAGCCTCACCCTTCTCCCTCCATTCCTTCTGCCTTGCTAAAAACCATTAGATGACATTCCTAAAGCTAGCCACAAGGTCTATTCCCTTATTTGCCCACTTTCTCTTCCTGAGGCTGACTACCCCCAGGCCCAACTATCAAAGTATTGAAGTCTGGCAATCAAAAGCCCCCTTTGATTCAGCAAATTAACATGCCTAATCAAAATACACCATGGCATCCTAGTCCAATCAAAATATCCCACCGCATCCTAGCCTGTTCTAATACATCACCACATCCTAGCCTGTTCTAATACATCACCGCATCCTAGCCTGTTCTAATACATCACCTCATCCTAGCCTGTTCTAATACATCACCACATCCTAGCCCGTTCTAACGCAGACCTCCCTTTTGTCTTCAAAATGACATTTGCAAGGTCCTTTGCTGCTGTTTTTTTTTTTTTTTTTGCCTGAGTCAGAAGGCAGCCACTTTAATTTTTCTTCCCTGCTTAATAGAGGAAAACGGATGTCTGGGTGTGGTTTGTGTCTAATCCGGGGTCCAAAAAGGAACCCCCAGTGTGCGGAGGTCTCCTTCATGCTTAGCATGCACATGGTCAGAGGTTGGTGTCCGAGCACAGTGACGACGATGACGATGATGAAATCATTGGTACTGTAATAAACAGAAACTGTCTTCTAAGAAGAAACTATAATTCACTTCTTATTTTCTACTACTCAGCCATCTTGCTGGTTCTTTTGTTTTGTAAATGTAGTGTATAGCCCAGAATGACTTTGAAATCATAACCTAGCCAAGGATGGCCTTGAACTCTGATCTTCCTGCCTCCACCTCCCGATTGCTGAAGGCCTGTGCCACCATATCCAGATTATTCACACTTATTTACTTATTTGCTATTTTATTTCATGTGTATGAGTGTTTTGCCCTCATGTCTGTCTGTGCACTACTGGCGTGCCTCGTACCTGTGGAGGACAGGAGATGCCATCAGCTCCCCCAGAAGTGGAATTACAGGCAGCTGTGAGCTGCTGCGTGGGTGTTGGGAATCAAACCCAGTTCCTCTAGCAGAGCAGCCTGGTCTCTAAAGCACTCACTCATAGCTTCAATGGTTGCATTCATTTTTAAATAGTTTTATATTTGGATTTGTTTACTAGTTTATTTCATGTCTTCTAATTATTCATTTTTTTGTGTGTTTTTCTTTTAAATTTTTAAAAATGTTGTGTGTGTGCACACATGTGTGCATTTGGTGCTAGGCAGAGCCAGGGCTTTGTGTTAAGTGAAGCCTTCCCTGAGCTGTGGGCCCTTTTGCCTCTGTTCTATGGAATAGTTTCTCTAGTTCTCTGCCTTCCGGTGCCCCAGTCTCTCATTTTTGTTAAGTTTCGTTCCCAGTGTTTAGTTCTGCTTTTCTAGTACAGTGCTCTCAAATGTTTTAGTTCTCACTGTCACTAAAACAATGTAGCACCATCCTATATCCCTGACAAGAATCCTTTGCTTGTAATCTGGGTCCAACGCCTCGCTAGGCCTGGGTGGGCACTTCTTACGGAATCCAGCTGCAGTACCAATGCTTGTCTGTCACGCTACGGGAACTCAGGACTTGGATATCTGCTCACCTCCAACTTGTGGCTGGCCACCTGACCTGCCTGCAGTCACACAGCCTGCTTGGTCGGTTTAGCCAGGATCTCCTTCACGTTTGAAGCTTCCTCTTAGTAATTTTCCATCCACTGGCTTCTCCCCGCTTTTGCGCTGGAAAGCCCGGCTTGGCCATGCTGGGTCTAGACCCACTCTGCCTCCCAGAATCTATTGTTCGACCTCCAGCTACAGGGAATAAAGTCTGACAAGATGTCTTAAACAAACAGCACAAGACATGTTTTCTTCAACACCCCTTAGCTTGTTGTAAACGTGAACATTTCCAAGGATGTTGTTTCATTTTTTAAAATTAAAAATAAGTCGTCGGTGCTGGGGTCCAAGCCACAGCTTGAACATGCTGAGTGCACACTTTTATGACAGTGACAGTTGTAGTCTCAGGCCCGACATAGTAGGTCTCCCCTTCCTCATCCTGGCCTCCACCCTCCTCCTTGTTTTCATTCTCCCTCTCGCTTTCTTTTGTGTTACATAAGACATAGTCTTTTTTTTGTGTTACATAAGACATAGTCTTATGTAGCCTAGGCTAGCCTCAAACTCACTCTGTAGCTGAGAATGACCTTGAACTCTTGATCTCCCCGCTCCCACTTCCTGAACGCCAGGGTTCACGGGCAGGGTTCACAGGCACGGCACAGCAGGGCAGTTTGGCGGGGACTGAGAAGTGAGCCCACCACAGGCGGCGGCCCTTTACCAGCTGAGCTCCTGGTTCCTCTCTGCCCCCTCTCTCCCTGCTTTGTGTTTCTCCAACTTAGGGCCTCAAAGGTATTACACAAATATTCTGTAAGCTTTAACTCCAGATTTATCATATAACACCTCCGTGTGGGATTTCACTTATCTTTACTGCTAATTTAATTGTAAACTTTCCTTACTCTTTCAACTCCGCGGTGAAGTGCATCCTTTGAGGACTCTGGCTGAGAAAGCCACTCAGGGTCATATATGTAGCCATTGTAAAAAACCCTCTAGAGCAGTCACACCCATGTCTTTCCTAATAAACTCACCAACTTTTGCCTTGCTCCAGCTCACCCTGAAATACTTTCCCATAGCATCACCAAGGGTTTCCCTGAGGGCTGGACCTGAAGCAGGAGAGAGTCCCCAGGCGGGTAGAGGCTGTGTTGAGCTGTGTCTGCCTGCTACACATGGTACTAAGAACATGAAACCCATAACCCTAGTAAAGCAAAGAGAGTCCATCCATTTCTCGAGGCCACGAAACTCTACCCAGGCTGGTCTTGAACTCACAGAGATCCGCCTGCCTCTGTCTCTCTTGTGATGGGTGGGACTAAAACCTTGCCCACCACTGTTCAGCATCCATTCCAATTTAAATGACTAAAGTTTGTAATAAAAGTTTAAAAACAAATAAAACTCTTATTACTCTTTTAAACCGGCTCAGTGAATGAGTGTATGGAGCATAGACGCTAAGTACGCCCTCATCAGATGATGTGATGATGGACCAAGGCTCAGTGGGACGTGGGCTTGCCCAGTCTGATTGGAATCCAAGCACTGGGGGTGGGAGTGGGGGCGGGCAGAGACAGGCAGAGCTCTGTAGCCCAGTGGCCAGCCAGCCTAGAGGAGAAAGTGGGCTGCAGGCTCAGTGATGGACCCTGTCTCCAAAACATTGGGTGGAAAGTGACAGAGGAAGACACCTGACATCAGCCTCTGGCCTCTGTAACACATTAATGGGCACACGTGCACACCCCAACCCCACACTAATGGGCATGCGCACCCCACTCCCACACACAGATGAATAGCTGCTCACACTGTCAACCCACACACATACCTGTGTGCGAGGGTTCACACATTCTGAGGCTGAACTCTCGCTTTTAATAGATAGATTACATACATACATGTACAAACATTAGTATTTATTTAGCAAATAAGGCCATTCAGGTTAAGGAGTGCTTGTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTCTCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCTCTCCCCTCCCCACCCTCCCTCTCTGTTCTCACTGCTAGAGAACAGAGTTAAGGACAGAAAAGAATGGGGGAGCTGGAGAGATGGCTTGGCAGTTAAGAACACACCCTGCTTCTGTAGAGTTTGGTCCCCAGTGCCCAGGGTAGGCAGCTCACAACTGCAATTCTAGCTCCAGGGGCTTCTAAACCTCTGGTCTCTAGAGCACCAACATGTGTGTGCATATACCCAAACACATATATAATAAAAAAAAAATCTGAAGGGAGAGGGTAAGAATACACCTTTTGAGCTGACACAGTGGGACAGGCACTCAAGGGGCGGGGTGGGACCACCAGAGCCACATAGTGAGACCCTGTCTCAATATACATATATACTTTTTGGTGTCAAGTTAGAATTGGAGTTATTAGAACTCAGTGTTTTTAAATATATAATGCTGATCAACACGGAAGCAAATGTAGTTATCGACATCTTGTTATAGCTATTGGTATGCAGATAGTACATGCGCCTATAGTTCTTGATTCTGGATACTAAAAAAATGTAGAAACAGTGAGACCCCACCAGCACTGTTAAATAAGTGAGTGTGTAAAATAAACGATAAAAAGAAGCAGTAAATTCCAGCAACAACAAACAAGCTTAGTGCCAGATCTTGGTCACTAAATAACATTCACCATTTTTTCTTAAATGGGAGAAAGTGCATACACATTTTATCACATGCCTAAGGCGCTGGAGTGTGAGGTCACTCTTTAAAGATGTGAGGTTTATTCCTCATCACTGCCAAAAACGACAGGCAGACAGACAGACATAAAACAAAATAGAGCATGGTGGTACATGCCTGTGATCCCAGCAATGAGAGGCTGAGGCAAGACATTCACTACAGGTTTGAGGCCAGCCTGGGCTACATATTGAGCTCCAGGACAGCCTGGTTACATAGCAAAATCTTGTCTCATAAAGACAGAAAAAGGGCCTGGAGCGATGGTGCGGCGGTTAGGAGAACTTCCTGCTATAGTTTAGTTCCCAGCACCCAACAGCAGCTCACGTTCATCTGTAACTCAAGTTCCCGGGGATTACCAGACATGCATGTGCTGTACAGACATACATATAGGACAAACACCCGTAAGCATTAAAAAACAAAATAAGGGAAAACAAAAAATTAAAATGGGAAGACAGAAGAATGGGGAGATCATTTGGGCCAGGCATAGCTCAGTAGCAGAGAGCTTCCCCGGGAATGTGCAAAGCCCCACGTTCCATCCCCAGAGCTTGCACAAAGGCTGATTGCAAGGCTAGATCTGGACTAAGAACAGAGGGAGGTGGCTCAGTGGGTAAGAGCCTGGCTGCTCTTGCAGAGAACCTCTGTCCAGTTCCCTGCACCCACACTGCAGCGCACAACTCTCTGTGACTCTTGTTCCAGGAGATCTGTTGCACTCGTCTGGCTTTGGAAGGCAGCAGGAACACAGACACGCATGCAGACAAAGCACCCATACACATAAATAACAACAACAATGAAAAAATTAAAAGAGATTTCCTGAAAAAAAAAAAAACCAAATATGTTAAACAATATCAAAAATGGTCAAAACCTGAGGGAGAGAGCAGGCGCTGTGGCTGAGTAGTAGGACAATTGCTGGGTATGTACAAGAGCCCGGGTTTCATCCCAGCACGGGGGAGAGAGTTATAGGGACAGATCAAAAGGAATGCTTTGAGTTAGGTCTGGAAAGATGGTTCAGTGATTAAACGCACTTCTGAGTCTTCTAGAGGACTCAGATTCAGTTCTCAACACATAAGCGACTGCTCACAACCACCTGCAACTCTAGCTCTTGGGGATCTGATGCCAAACTGCATGCATGCGGTGCACAAACACACGAGCAGGCAGAACACTCATACACATAAAAGTACCAACCGAGACCCCTGAGGCAGGGGGATTTCTGAGTCCAGGATGGTTTACAAAGCCACTTCAGGTCAGTCTTAGGTACACAGTGAGACCTTGTATCAAATAAATAAAATTTACAAAATAAAAATAAGTAAAAAGATATTTGTAAATTTAAATTTTAATGAAAATAAACGATGATGATAAACACCAAATGTGAAGAAGGGGCTTCCAGCACCTGGGAGATCCAAGCTTTGTCAGGACCTGTGACATGGCAATGTTCTTCCAATGCGTTAGAATTATGAGTTAGAGTCACCTAGTGATCCATCCGCAAAGCGTACAATTCAGCGTTGTCTTCCATGAGCCTCTTTAAGATGGCAGACGTGCACGTGACCCGGAAGGAACGGGCTCAGTAGTGAGGTCGTCTCCTGTCTCATCTCCATCACCACCAGCTACGAGCTCTCTGAACGGAGCATCTTCTACCTGAGGATGCAGGTCCTGAGATCTCAGCCCGGGTGAGGTGAGGTCTTCCCTTGAAGGGTGCTTGAACTGGCTTTGTGAGAGAGTGGAAACATTGCTTCCAAGGTACCGTTCCAGGCATCCGGCTCTTGGGAAGAGTCTCTGCAGGCGCCCCTGTACCTGCCCTGTGTAGAGGGTTCCTACACCCTTGGTTTAGTTCTAGAAACAGGCTCTCTCTATGTGGTGCAGGCCTGGACTCCTTGGAGCAAGTGATCTTCCAGCCTCAGTTTCCACAGTAGCCATGCCACCTGTCTGAAATCTTGTTCCAAAAGCACTACTTAAGGCAGTGAAATGTATCTATATATATGATAAAATTACAAACAACACATTTATTTATGTAAATAGTGTCTGGAATTAACCTGCCTTGGCCTCCTGAGTGCTGCGATTAAAGGCATGCACCACCACTACCTGGCTTTGATTTGGTTTTTTAATCACAGGAACATATAGACAATTTAGCATTTTCAGCATCTCTAAGCCTACAGCTTGGTGGCATTAGCTACTTTACAGTGTGCAGGCGAGTGTCCTCTAAGCAGCCACATCTCCGGCGCTTTGTGGCTTGTCTAAGATCTCCTAAGAGACAGTGTCTCTTCTGTGGGTTCAGACCATCGACCCCCCGCCCCTTTTCTTTGATTTGTCTTTTGACTCTGTATTTTGCTTGCTTGTCACTGCTTCTTACATGTCACAGAAGCTAGGGACTTTGTAGTTTATCTAGCTTCTATCAGTTGCGTCTTGTGGATGTTTTAAGACAGTAATGGAATCTGATGCAAGACTTATCTACTTAATCTTGGACAGAGGATATGAAACCATTCAAGTGTCTGCTCTTATTGTTGAAGATTTCATGAGCAGCAGTTTGCAGCCGGTCAAGTTATTGCTTTCAATATGATTTGAAATTGTTTGCCGGAGAGATAAAAAGCCTGGAAAAATATACAAAGGAATGAAAAGTCAACATTCCACTTCTATCCCCGTAACCAAGACCAAAACAGAAGCCGATAAATGCTCTCCCTACCCCCCACTCCCCTGCATCTTGGGCTTTGTCCATCCCACACGAGGAACTGTATTAAAGGGTCGCAGCGTTAGGAAGGGTGAGAAGCATTGCTTTCAAGGGCGGATGAAAAGAGTTTTCCTCCCTGGCAAAGTATATTTATAATTTCAAAGAGCCAATCTGAACCATCACTTAGAACTCTTTGAAGTTTGGCATAATTTCCAATTGCCAACTAGCAATTTTACTCATCTTTGAACACCGAGCGCCGGGCATGTGCCAAGCACGGAGTGGGAAGCAGTATCGTCAGACAGGAAGCAGGAAGCAGAGATTCTGTTTGTAATCTAGGGAACTTAACACCTGGAGTTGCTTCCAGAAAACAAACGTGCATCTGTGAGTAGTCTCAGGTTTCTCTGGGTTTAATATCTTGGTCTAAATTGCTCTCTTACTGCCAACGGGTGCCTCCTCTTCCAAATGAGCCTGGCTCTCCTCCCTGGATGACTTGGGGGACCAAGAACCAGAACCTAGATAGATCAGAGATCTAGGGTAAAACCAAACTTTGCTGGTTTAGAACAAACAAAACAAAACAAAAAACTCAAGCAACCAACAAAACAACCAGTTCTAGCCTCCTGCGTGACTTTGCCACAGGCCAAGGGATCCAGGGTAAAGCCTGGCTCTGTTTTCACAAGGAACATTTTATTTTCTCCTTATTAAAACAATACTAATGTGGGGTCTGGAGAGATGGCTCAGTGGTTAAGAACACTGACTGCTCTTCTAGAGGTTCTGAGTTCAAGTTCCAGCACCCACATGGTGGCTCACAACCATCTGAAATGGGATCCGATGCCCTCTTCTGGTGTATCTGGAGAGTGAGTGTATTCACATACATAAAATGAATAAATCTAAAAAAAAAAAAAAAAAAAAAAACCTCAAAAAAAGCAAAACCAAAACAACCTGATGCATGGGGGTGGTTGGGAGAGGGCTGGGGGTGAGGATGCTGTGTTCTCTGGTGATGAGCTGGAGGCCTTGGATGGGGCGGCAGGGAGGAGGGTAAGTCTATGGGGGTATCCCTAGCTGAGATTCCTACCAGAGGGGGATATAGAGACTGAAGTGGCCACCTCCTGTAGCCAGGCAAGACTTCTAGAGGAGAGAAGGGGACATCAATCGCCTTGCCTATAAGAAGTGCAGGGATAAAGATGGAGCAGACCAATATAGCCAACCAATGCCCGGCCCAACTTGAGATCCATCCCATGTGAGAGAGCGGATCCCTGACACTACTAATGATGCTCTGCTAAGCTTGCAGTCAGGAGCCTAGCATAACTGTCTTCCGAGAGGCTTCATCCAGTAGCAGATGGAGACAGATGCAGAGACCCACAGCTAAGCATTGAGTTGAGCTGGGAGTCTTGTGGAAGAGATGGGAATAGAACTGAGCAGTGGAAGGGGGTCAAGGATGCCCCAAGGAGACATACAGAGTCAACTAACCTGGGACCATGGGGGCTCACAGAGCCTGGGCCACTGACAAGGAAACCTACAGGAGCTGAACTTATCCCCCCCACCCCCATCTGTAGCAAACGTGCAGCCTGGTCTGTATGTGGGTCCCCTAACAAGTGGAGTGGAGCTATCTTGGTCTCTGTTCCCTGCCATTGGATCCCCTCCGCCTCCCTGGACTGCCTGGTTGGGCCTCAATGGGAGATGTTGTACCTAGTCCTGCTGAGACTAGATGTCCCAGGGTAGGGTGGTATCAAAGAGGTATTCTCTAAGGAGAAGGGGAGGGAGCAATGGGGGGGGGGGATTTGTAAGGGTGGGACTAGGAAGAGGGGGCTATGATTGGGATATAAAGTGAATAAAAAATAAATTATTGGAAATAGGAAAAGGAAAAAAAATACTAATGTAGGGGTGGCTGTGTAGGTGAAAAACGCCCAGCACCCAGGTGAAAGGTTGGCAAGGCTGAGCCTGATCGTAACCCCAGTGGCAGAGAGCAGAGACAAGCAGACCATGGAGGTGTAATGGCCAGCCAGCATAGCCTCAGGGGCAAGCTTCAAGTGCACTGACTCTTATAAGGCGGAAAGCAATAGAAGAGTACACTCTCCCCCACCCCATCCCATCCCCTGAAACCTATTTCCACCCCCTCCTCACTCCCATTCCCTAATGAAAGGAATACTAAAGTCTGGAGGTATATATAGCTCAGTGGTATCTCTAGTTCCACAGTAAAGGGGAATAGTGGAGTGCTAGAGCATTAGGTTCTGGGGTCTGGCTCCAGCACAGCAAAACAAAGACAACAGTGATAAAAGCTCATACCAGAAGAGATCAGAAATAAGAAGAAAAACGAAACCACATGTATTCTCACTATGCAGACTTTATTTACTAATCCCTTACTACATGCTAGCCAAGGCTCTAGTGTTTTCTTTTAAAGTTATTAATTTATATCAATTAATTTATATGAAATAGGGTTTGATCTATAGCCCCAGCTGGCCTAGCTAGACCTCCCTATGTAGCCCAGGCTGCTCTCAAACTGGCAATAAAGTGCTGAGATTACAAGTGAGTACTACCCTGCTACATTTAGTTTTGCAATCATCTCATTTTCTAAAGACTCATTTTGTGAAAATTTCCCAGGTGTGTGTGTGTGTCCGCTAACCCTAAGCCGGATATGCCACCAGTTCAATTTTCTGCTGTACTGGGAAGTGGGGGGGGGGGGGGGACGGGACGGGGGACGTAGCGCCGGACATTAAAATGGGGTCGGGCTAGGGTAAAACCGTGAGACTCGGTCTGGAAATCTGGCCTGAGAGGACAGCCTGGCAATCCTCAGCCGGGGTGGGGACGTCTGCCGAAGATCCTTGGACTCCAGCAACCAGTGGTCGCCACCGTCCATCCACCCTAAGGCCCAGTTTGCACGGCGGAGAACAGCTGTGCAGCCACGCTGGACACTCACCCCGCCCGAGTTGAGCCCGCCCCCGGGACTACAGGACCAATAAGTGATGAATATACCCGCGCGTCACGGAGCACCGGCCAATCGCGGACGGCCACGACCCTAGAAAGGCTGGGCGCGGCAGGAGGCCACGGGGCGGTGGCGGCGCTGGCGTAGACGTTTCCTGGCTATGGTGGTGGTGGCAGCGGCGCCGAGCGCGGCCACGGCGGCCCCCAAAGTGCTACTCTTATCTGGCCAGCCCGCCTCCGGCGGCCGGGCGCTGCCGCTCATGGTACCCGGTCCGCGGGCAGCAGGGTCGGAGGCGAGCGGGACACCGCAGGCTCGCAAGCGGCAGCGGCTCACGCACCTGAGCCCGGAGGAGAAAGCGCTGCGGAGGTGGGCCCGGCGGGCAAGGCTGGGGCGCGGGGCGGCAGGACTGGGATTGGGACTCTCTCGTGTGTGCCAGCTGGTGGGCTCCGTACGGTGGGTTAGATTCACCTCTAGTGTCTAACCTGGGAAGCGGAGCTGAGGGGGATGCCCCTCCGAAGGTCTGCGTCGGGGGTGTGTGCAGGAGCTCCCGACACAGGCACAGAAGAAGGTGCCCGACGCCCAGTCCTCTGTAAATGCTCGCTCTTTGTGGTCGTAGGGTAGGAACCGCTCCAGCTGTCATTGCAGCCACTTGGGAACCCCACCCTGGGAACCGAGTCCACAGCGTCCGGCATCCCGAGAGTTTGGCTTGGGGAGGGACAGTTGGTAGCGTCCCCGCCGCCTTCACGGATATCGCTCTAGCAAGGAGCCTGTGGGACGGAATTGGACCCAGAAAGTAGCGGGGGAGGAGGGAAGAAGCATATGACGCAACGGGAATGTATCAGCCCGGTGGTAAAATGAGATCCGGGTGGACAGCCGCACGGGAGAGAATCAAGCAAGTCTTCAAGGCCTGTGGATAGAAAGCAGCGTGTGTATGCGTGTGCGTGTGCGTTTTGATAGGAGCTTTAAGCGTGTTTACTTGCTAAGCCTTATTCTGTAAAGTCAACGAAAGCACCAGCTGGCCACGTCTACAAATGAAGACACATGAAAGCTGGAGATGACTCAGTTATGTTCCCTGTCTCCTCCCCAAGGAAACTGAAAAACAGAGTAGCAGCGCAGACTGCTCGAGATAGAAAGAAAGCCCGGATGAGCGAGCTGGAGCAGCAAGTGGTGGATTTGGAAGAAGAGGTAAAGGGACTTCAGGCCATGCTTTCATCCCATCCATATCAGGGCCCATCCTAAACTGCTTCAGCCCTTTAGAATACAACCCAAAGTGCCATTTAAAGTTTAACCAGCCTAGCAGATAGGCCGTGAAAGCAGACGTGACTCACCCTGGCCTGCCCTCCCCTCGGAGATTAGCCAGGTTGGATAGATCATTGGTTGCTTAAGCTGTAGCGCCGCCTGTCTTTGCCAAAGGCTCACTAACGCTGCCCTTCCTTCTGGGATCCCCCCCCCCCCGCGCGCCCCCAATCCTCCCACCCTCTGTATCCTTTCTGCTGTCAGTGCCCTTTTGTGCCCCTCCACCCCGGCATCCTTTTACCCTTTGGGGAGTTATTTTAGTTTCTAAGTTAAGTTTAGTTAACTTTAGCTATTTCTAGCGTTTCTAGGCATTGCCACATTTACGTCCATTTATATGCGCACGTGCGCCCTGGTTTGAGTTTGGGTCACCTCACTTTGTAATACACTTTCCAAATTTATACATTTTCCCTGCTAGTTTCCTTTCTCTATACAGGCGAGTGGTACCTCACTGTGTGTGCACCCCACTTTCACGGTTCTCTGGGCATCTGTGCTCAGCATCTAGGCTGCCACCATTTCTTTGCCATTGGACCACTACCACTTGCACCAACACTTGCCATTTCAAGACAGGATGGTGAATTATTTAAAGATTATTTTTAGATAGGGTCTTAGGTTGGCCTGTAACTCATGGCATGCCTCCTGTTTTACCATGCTGACATTACAGGCAGTGAACCACCTTGCCATACTTTTTTTTTTTAAAGGTAGTGTATTAACACAACTGTAAATTCAAGCTGCAAGTGACCTTTTTTTTTGGCTGAAATCTGCGAGTAGTACTTGTAGGCATTATGTTGTTTCTGTCACCATTGAAAACACTTTTGTTTTCTTCAGAGATTGGCCTTGAATAAACTTGCTTCTCCCGCCTCAGCCTGCTTGAGTGTTCAATGGCATTTTTGGGGGGACAGCTTGATGTCTCCCAGGCTGTGCTCTAACTTGCTGTGTAGCCAAAGATGACCCCAAATTTGTTTCTCTTGCTGCTATGTCCCAGGTGCTGGGATTACAGTTTATGCAGAGCTGAAGATGGAGCCCAGGGCTGCAAGCCTGGGAGGGCAGGCCTTCTCCCAACTCCTCTGTCCCATTAGCCACCGGTGACAGAATGGCTGTGACCCGCACCAGCAGGGAAACAGCTGGAGCAGAACTTGCAGTGGATTCTTTAGTGACGGAACCACACGGTCTAACCGCACGGCCTCTTATGTGATTCCTTACAGAACCACAAACTCCAGCTAGAAAATCAGCTTTTACGGGAGAAAACTCACGGCCTTGTGGTTGAGAACCAGGAGTTAAGAACACGCTTGGGAATGGACACGCTGGATCCTGACGAGGTTCCAGAGGTGGAGGCCAAGGTAAGTATTGGGAGACCTGGCTGCAGCACTACCTGGCTGCAGGTTTGTGTTCTGGACCTCCAATCAAATCCTTTTCTCTTTTCCTTTATGAGACAAGGTCTTAATGTCTAATTTTGGCTGGTCTTGAACTTGTGTCAGTTCTTTTGCTTCTAAGTAGTAGGACTATAAGCACCTGCCCCTGTGCCTAGCTGAGGAATCCTGAATTTTCCCTGTTTCCTTGAACTAAACTTATGATCTTCTTGCCTTAGCCTTCCAAGCGCTGGAATTACATGCATGAACAAGTGGTTTGTTTCTTGGCTTTTTTGGGGGATAGGGTGTCATGTAGTCCAGGTTGGCCTCAAACTTGCTCTGTAGCTGATAATCCTACCTCCACCTTCCAGATGTTACCATTACAGGCAGATGTTCCTTTGTGTGGTTATGTAGGTGTGTATGTGTACATGGGTGTGGGTTTATACACATCTCTGCTTACGTACAGAGGCCTAAGGAGCATATAGATGTCTTGCCCTAGCACTGTCCACCCTGCTCCTCTGCAGCAGAGTGTCTCACTGAATCTGGGGCTAGGCAGGTGGACAGCAAGCCCTGGTGAACTTCCTGTTTCTGCCTCCCTTGATGCTGAGGATTTGAACTTGGGTCTTCAGGATTGTACAGCAAGCACATTATATTCAGAGCCACCTCCCCAGTTCCTTTCGAGCCCTTTGAGGAGCAGAGACTCACAGCTACCCAGCATGTATATCCTTGGCAACTTTTACTCACTGTGGTCTTTCCTTCCAGGGGAGTGGAGTAAGGCTGGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTATGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCTCCCCAGAACATCTTCCCATGGACTCTGACACTGTTGCCTCTTCAGATTCTGAGGTAGAGCTTATTCTGTAGCCTAAGTGGCGTGTGACACGCTTAGCCAGGCAAACGGAGAAGTTAGTATTGGTGGGGTTAGGATTAAGCACTTTCCTAGTCTGCTTAAGTGGATGGAGTAGGGGGAAACTGTTCCGTGGGTGGGTCCTATGATCTGAGAGCATAAGTCTGGTGGATGGCTGGGTCCTGTGATCTGAGAGTGTAAGCCCTAAGTAACATTGTGGAACCCAGTACTAAAAGTATTTCTGGTAGACTGTCACATTCATTCTAATAGTGAACTCTTTTGTGTTTTGCCTCTTGTAGTCTGATATCCTTTTGGGCATTCTGGACAAGTTGGACCCTGTCATGTTTTTCAAATGTCCTTCCCCAGAGTCTGCTAGTCTGGAGGAACTCCCAGAGGTCTACCCAGAAGGACCTAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACCTCATCAGCCAAGCTGGAAGCCATTAATGAACTCATTCGTTTTGACCATGTATACACCAAGCCTCTAGTTTTAGAGATCCCCTCTGAGACAGAGAGTCAAACTAACGTGGTAGTGAAAATTGAGGAAGCACCTCTAAGCTCTTCAGAAGAGGATCACCCTGAATTCATTGTCTCAGTGAAGAAAGAGCCTTTGGAAGATGACTTCATCCCAGAGCTGGGCATCTCAAACCTGCTTTCATCCAGCCATTGTCTGAGACCACCTTCTTGCCTGCTGGACGCTCACAGTGACTGTGGATATGAGGGCTCCCCTTCTCCCTTCAGTGACATGTCTTCTCCACTTGGTACAGACCACTCCTGGGAGGATACTTTTGCCAATGAACTTTTCCCCCAGCTGATTAGTGTCTAAAGAGCCACATAACACTGGGCCCCTTTCCCTGACCATCACATTGCCTAGAGGATAGCATAGGCCTGTCTCTTTCGTTAAAAGCCAAAGTAGAGGCTGTCTGGCCTTAGAAGAATTCCTCTAAAGTATTTCAAATCTCATAGATGACTTCCAAGTATTGTCGTTTGACACTCAGCTGTCTAAGGTATTCAAAGGTATTCCAGTACTACAGCTTTTGAGATTCTAGTTTATCTTAAAGGTGGTAGTATACTCTAAATCGCAGGGAGGGTCATTTGACAGTTTTTTCCCAGCCTGGCTTCAAACTATGTAGCCGAGGCTAGGCAGAAACTTCTGACCCTCTTGACCCCACCTCCCAAGTGCTGGGCTTCACCAGGTGTGCACCTCCACACCTGCCCCCCCGACATGTCAGGTGGACATGGGATTCATGAATGGCCCTTAGCATTTCTTTCTCCACTCTCTGCTTCCCAGGTTTCGTAACCTGAGGGGGCTTGTTTTCCCTTATGTGCATTTTAAATGAAGATCAAGAATCTTTGTAAAATGATGAAAATTTACTATGTAAATGCTTGATGGATCTTCTTGCTAGTGTAGCTTCTAGAAGGTGCTTTCTCCATTTATTTAAAACTACCCTTGCAATTAAAAAAAAAGCAACACAGCGTCCTGTTCTGTGATTTCTAGGGCTGTTGTAATTTCTCTTTATTGTTGGCTAAAGGAGTAATTTATCCAACTAAAGTGAGCATACCACTTTTTAAAGTCACTGAAAGCTTTTTCTTCAGGCCAGTTGGCCAATATCAGTTACTAAGTGGCAGAGATAGAACCTAACCACCTTTTGGGGGTGGGGTGGGGATTAAACCTAAGATGTGCATAATGGGCAAGTTACATAAGTTGTACCACTGAGTCTCAGCTCTTTAAATTACTGTTTTGCTATGATAGGAAGTATCAGACTTCACCCTGATTTTACCTCTGGACACTTTTGAGCTGTGTAACTGAGGGGACAGGTAACTATAACTTTGAAAGGAGGATTCTAGAGTGTCTCGCAGCTGAACATCTGCCACCACCTGTGCTCTGGAAAGTTCAGTTTTTTTTTCTCCTGACCCACTTTGGAAAGGTTTTAATCCCTCATTGAATCTTAAGTGTAGGCTAGGGGTATCTTGTCTAGCATGCATGAAGCCTCGGTTCCATCTCTGGAATGGAAACAAGCAAATTTATTCAGAAAGAAATCAACTACAAAACTTCAAAGACAATGACAACATCTTCATTGTGTATTCTGCCCGGGCAAAGAACTTCATTTTTCACTGATAGAGGCAGATTAACAATTTAGCATTTACATATATCTTCCCTATCAACATTACTTTGGGGTGATCAAAGTGAACCTACAGATAGAATTCTGAGAGTCTAGTCAGTAGGTCCAAGCAGGCAAAGAATACAAGCTCGTGTTGACAGCTGTGATAGGAAGGGTTTCCATGCGCACACCCCAGGGCAGGGACCTGGTTGGTAAGTCCACAGCTCAATCCAGTGTTTTACAACACAAGTTCACTTAGGCCAAGTTCCAGTGTTGTGACTGAAAGCTATCTCATGAATACCTGAGGACCAATAATCTATTTAGGGACTATAAGGCAGATATTATTTGCCACCATTCACAGAATATAGGTATTTCTAAGTTAAAACTCAAGTCATTTACATTTAATAGCATTGCATTGAAGTGGCTGCTATACTACCAGGATAGGTCTGTGTAGATTTTCAGGGTTTCATTTCCTGTACAGATGGACAAAAAGGATAGACTGATCAGCTTTGAGAAAGCACCTGGTTTTCAAGAACATTTTCATACCGAAACACCAAGCTGCCTGGCTAGATCCAAAAGTCAACCTTTTTACTCTGTGAAACCAAATACTCTAGTAATAATGTGTTATTCCAAAGTTCAGACTAAAGGTACACGCAGTGGCTGCAGACAACATCCCTGAGCCTCACAACAGCTAGGCATCTGCCTCATTGCTTTTCTATCAGATGAGCTGCTGGAGCTAGACAGCAGTCACGCGGCCTACTCGAGTATTCCAAGCATCAATTCAATTCTTGTCTCCTAGAAACTCAAAAACTCAAGTGTTATTTTTCTAACTGTTGAGATGAAATCTATATTTTCTTACTTTGTATGTTCCATGTATAGGTATGGATTACCATGGGTCAATCTTTTTTGAGATAAGATCCCTAACTGAACCTGGAGCTCACAAATCCAGGTAGACTAGCTGGCCAGTGAGCTTCAGGGCTCTTCTACCTCTGACTTTCCCAAGTACTGTGATAATAAACGTACAACCCCTAGCCCCCTTTAAAAATGAGTGTTAGGGATCTGAACTCAGAATTGCTCGCAAGCCAAGCACTTTATTGACTGACCCATCCCCCTAAACCATTTGAGACAGGGTCTCTTGCAGTCCATGCTGGGCTCATGAGATCAATATGGGACAATGACTCTGAGTTTGGGATCTTCCTTAAGCCTCTTCTCAAATCCTGGGATTATAGGACTATAAAACTCCAAATACTTTTATACCCTTGTGACTTAAATTTTTTTCTGACAATGTGTTTTAATCATATTTACCCCATATCTAGTCTTCATTTCCCCTCCTACTGAACCCTCCCTTCCCAATTAATCCCACTTCCATCCTGTATGAGTGTGTCCTATAGTATTTAAGGTTGCTTGTATACACATGGGCAACTTACCAGTGGCTACATAACTGAACAAAGTGACTCTCTAGCAACCCTGTTCACGTCTATCATTCATGCAGTAGGATGACTGGTACACCCACCCAGGCAATGCTAAAGTCAGCATCAGTGTCTTACAGGAGCTAGCATTTCAGCACTGTTCAAAGCGCATCTATAAAATGCCACCACTAGTCTGAGGAACGAGGGGACCAAGAGAACCAACTCAATGCACATCAACCTATTTTTGAGTATCTACTCATTTTGCACTCACAAGCCATGGATCCTGGAACTCACTGTAGACCAGGCTAGCCTTCAAATTTTGGGGCTCCTGCCTCACTCTTGGGTGATGGAATGACAGGCAAGTACCACTACGTATGACTCACTGAGTCATACTCCATTGTCTCAATGAAGTTGCCATGACAACATCAGACATTAAAATGTCTGTAAAGCCAACAGCTGGTCAAAGCAAGAACCTTGGGACTAACTAGCAGGTGAGATACCGAGCTGTATCTATCTATTCTAATCCCAGTTTCCAACCCATCATGTTAGATAACTTTTACTTTTACCCAGGGCTTTCAAAATTTGGTTAAAAATAATTTTTTTTCCTGCAACTGTAACCCAATGATAAAATTCCTTGCCTCACGAGGATGCATAGACATCATAGACTGCCTTATCTCTTCAAACTCCTCCAACTTGAGCTTCCAACTCTACATCTCACCTTTGAAGGCTCAAGTCACAGGGTCAGCATCTCATGTCCCATGGCAGTGACCTGCTAATGTTATTGGTACGTTAGCAAAGGCAAAGCAGCCTGCCTAGTCTAGAAACAGCTCACCTTTAACCCCACAGTATCAGGCTTTCGGGACAAATTTAAGTTTTCCACTGATAAGGATGCCCCCTTAATTAAAATTTAAAGCTAAGGAAAAAATGCTTAATTTACATTTATACAGGATTACAGATACTTTAAAAGTTCAAAACATTGAGTTTTATTGAAAATAATAAAGTACAGAAACACCAGATTCTCATCTTTAAAGCAAATCTGACACATCTTCCAGCACGTTGTAGCACTGCAGCATTCTTGTTGCTGTTAACAAAGGCGGCTCCAGGGCCAGAGTGGTTTGGCCTGCTGCCTAATAGTCTCCCTCGGCTCTAAGGCCTGCCTTGTTTCTAAATCTTAGTTTTACCTTTTTAAGAACGAGCAGTTTTTAAACTGGTTCTTGTCATGAGAACTGGATTCTCATATTATTAAGAACAACAACAACAAAAAGCCCCAAGCCAAGAACCAAAAAACCCACATACACCCGACTCAGACTCACTGAAAATACATTTGTTCATCAGAGCTCACCTGCTTTAGATAACTGTTGACTGTCACATTAGCATACTGAGCCAATGTTGGATTCACACTGTAAAAACTATACAAGATGAAAAGACCTGTTAATTCCTTAGGAAAACCTTAAGGCAGAAGCCAAAGTCTTATGCTAGAGAGGAGAACAGAAGGCAAAGGTATCAGAGCTGTGGAGACAACTGGGTGTGTGTAAGCACCACAAGGATGAAGGTGATTTCTGTACAAACATGTGCAAGAAGATAAAATCCAAAAAGGAGCACAAAACATCTACTTTCCTGTTGAAACAGGGTCATGTCAGGTAAGGACTCCTGACAAGTTAAGACATCTCTGCTCTCAAGTGGTTACCAACTGCATCAAAGCCACTCGGGCCTTTCACAGAGGCAGTCCTGGTGTTTTAGGCCCTTTGGAAAGCTGCCACTACCTTCCTACCCTAACACTGGGCTAACTCCAGACTCTCGGCATCCCTGCATGGTTCTAAACTGTTCTAAAACTTAGCACAGAGATTTCTTTAAGGCTATAAACTTCACAAGCTGGTCCCATTAGATAAGCCAGGAGTTTTCAAATGACACGAGCCAAACCCTTGCACATTCACAGAAGACAGCTTTCATTCCCCTAGGAGTCTGAGATGAAGAAACAAGTAGCTGGCTTCAAGACTGGTTTGAAGGTTGATTAACTTTATTGTGTAGATATAAATATTTTGTTTAAATATTAAACATTAAACCTTTTCCTGACATCTAGACAGAAACGGAGAGAGCAGGAACAACAGCAGAGGAGACAGTCCAAAGACAGACGGACTCCTATGCCATCTGCAGGAGGGAGGCCAGCATGGGTTGCAAAACGCCAAGAAGCTACGTTTCTAAAAAGTCACCCCCCCTCAGCATAAACCTCTTCTCTGTTCTCCCCTATACAAAGGGAGAAGCAAGCCAGAAACTGAAAACTCAACTGAGGAGGAGTTCAGCTGTAGAAAGAGCCGCCACACTCACTGGATGGATAGCTTACTGCTCTGCAGCGCTGAAGGACTTGCGAAAGCCCTCATTACACGTCCTGCCATGCTGAAGAGCTCTTCCTGAGAAATTAAAAACTTTAACCCTGGTTATTTCCAAAGAACACCTTGAGACTGGTTCGGGTACTAAAGGGTAAAGATTTCCTGCTGGCAGGAGGCCATCTTCTGCTAACTTTTAGGCTTACTGCACAAAAGCTTAAGCACCTGACAATTAGCTATTTCAGTAAATCTCCAAGACACTTCTCCATTTCTTTTCAGCTAATTCACTGTTTTTGGAACCAACATTAAAAAAATTCAACTTGCAAATACAAGCACAACTTTCCCTTTTTAAACTCTAGAAGCAATCAATTGTAGGTTTAGCTGACACAGCATGTCCTTAGGATTCATGAAAAGACATTTCTCTCACAGGCAATATACCTCCCAGTCTTTAAGTCAATCACTGAAGTTAACTGAGGTGTAAACATTCCTGACTAACTGAGCCTATCCGTCATGAAAGGAGATCAAGGGCTACTACTTGGGTGATCCAGCTACACCAACCTGACACCAACACAAGTTTCTTTGCTTGTTCCATTCCTTCACAAGAGACAAGTCCTGCTCTCTTCCCTCCCGAGCCCCACGTGTACAGTGACCACTACAAGTAGCTCAGCACATGACTCAGCAATTAGGGTGCAGTGGCGATTAGGAGCACTCCTGTACAGAATCATCTCAAGAATGAATGGCTTCAACAATGTGACATGACCTAAGTCATCGGAACACATCCAGCATCTATAGCTGTCGTTAAAGAGACTGTAACATTTCCTGGATAAGCCTATTAAAAAACTGCATTTCCCTTGAGATAAGCTTCCTTGGCAAAAAGTTGAATTCAATAAATGGCTACCCACAATGACAGTCCCACCCAAGTCACAGGCAGAGGAGATATTACACCCGTTTCATAAAACTTTCAGGCCCCTATACTCTGCAGGCAGGCTCATTTCTGAACGCAGGAGCCTTCTCCGACTTGTCAAGTTAGAGCAGAACGGGTGTCTAGAGCTCCATCTCCTCCTCTGTGCTAGTAGCTGCCTCCAGACTACGGTAAAGCGGCGCGTCTGCGCACTGAGGTTCCAGCAACCCTTCAGTCCTCTGTGGGAACGCAGTGCCCGGAGCTGCGTGCTTTGCTTGGCTCTCTCTCCTGTAGTTCTTAGGGCTAGATGATGGCTTTGGCTTCTCAGGAAGGAGTTCAGGGAGAGGTTTCCAGAGCACAAGCTCCATAGAAGGACGGCTCCTGGGATGTAAAATACAGATTTTTATCAAACTCTAGGAATGCAAATGAAGGCTACCTGTAACAAGCTGCTGTCTCTCAGTCAGTCTAGGCTGCCTGTAACAGGGTCCTGTTCACTCCCAACGCCTCAGTCAGTTAAGAGCTGGTGGTCCTGAAAGAGCTGGTCTGTTGTTGGTGTATCCCTATCCATTAACTACTACCAGTTTCAGAATTATTTTATCTTGATGTCTTTTATCAGTTCTCATTATAGAAATTTAAATCTTTTAATTAAAAGTGTGGCTGGGTCATGGTGTTTCATGCCTTCGGGAGGCAGAGGCAGATGGATCTCTGTGAGTTCAAGGCCAGCCTGGTCTACAGAGCGAGCTCCAGGACAGCCAGGGCTATACAAACAGTCTTGAAAAGCCAAAGAAAACCAAATGTGTTCACTTCAGCAGAAGATATACTAAACTTTGAATAATACTGATTAGCATTTGTTAGTTAACCAATGCTTCATTTTAAAAAAGAGCTAGAGATATTTAGAGTTCAAATGGACTTAGCAAAATAAAAAGCACATTTATGTGCATGTGTGTCTGAGTGTCCATGGGAATATGAACATGTGTTACAGTAGGGGCTGGTGTCTCTTCACAGCAACAGAAACCCTAACTAAAACCCTAAAAGAAGTGAGCATTGTTTCCAGGCCCTCAAATCTGTAGAAGTTCACATGCTGGAGACTGAGCCCAGGACTCACACATGAGCGAGTGCTCCACTTCCTAGCAACATCACTAGCTCTATATGTATTTTAAACCAAATCAACACCCAGCCTTACAGATGCCATAACTAGCAGTAATATAACTATCCAAGGTGAAAAGTAGGGCCTTTAAGCTGGGTGTGTTGGTGCACTGCTTTAACTCAGCACTCAGCAGGCAGAGACAGGTGGGCCTCTGTGAGTTCAAGGCTAGCCTGGTTTACATAGTGACTTCTAGGATAGATGGAGCTGCATAGACAGAACCTGTCACAAACAAAACCACCACCACCAACAACAACAGCAATGTTGTTGATCTAATGCTGTAACCTGAAGTAGGTATGTGGGGGTGGAACTCAGCTGAGGATCACTGAATCACATCACTAGCTATAATGATAGAATACACAGAGACGTTTTATGGAACATTCTTGCGTGACTACAGTCTTTTGTTTAGAATGTGGTACTGAGTCTAACGCACGCTAAGCAGCTATTCTAGTGCTACATTATCTCCCTACCCAATGGCTAGCTGATATATCACATTATTATCCATGAAAATGAAATCCTCGGCAAACATTAATTTTTGATAACTTTTGTTTCATACAGTTCTGAAGTAGAATGTTTCACAGTTAAAGCAAAACAATTACATGAAATATGTGAAATAAAAATGTTTTTCTCAACCATAGCTGTGAGCAGTACCTTTAATTCTAGCACTTGGAAGGTGCAGGCAGGAGGGTGATAAGTTCTAGGCTAGCCTAGGCTACATGAGCACCCATCTCCAAAGTGAGAAAAAAAAAATGTCCTTACCCTTGGTATAGGAAAAATCTTCTGGGACACAGAAGTAAATAAGAAGATAATGAAGAACACTCTCAAAGGCCCAGCTCTGGAAAACTACTGAGAGCAGTAGACACTATTTTGAGCAGAAGGGCAATGTGACCTGCATACACAGTGGCTACACTACTGACACACCCTCAGGGCTGAATAGTTAATTATAAACTCAAGCTAGGGCCTGAGTGAAAACCTGGACCTCCCACAGCAGTAGCTGCACTGCCCCCTCTCTGCCTAAAGGCAACAGTGGCCAGCACTCCTGAGGTCCGCGTCCCAAGAGCACTTTTCAGATCCTACGCTCGCCCTCAGTGATTAAGGCTACGGCTCCCAGGCAGTACTTAAGTGGACAGCACAGCACAGCACAGCACAGCAGTTGAGGACCAGCCAGTCCACACTAGATCTAAGCAGAGCACTTTCTAGGCTGCCACTTTGCTTGGCAGACTCTTGGGTTTGAGTTCTACTCTGAAAATACAGCAAACCAGTTAACTGAGCTTATTAAACCATGGTGTTTTTCCATCTTTCTTTCTGTGCTGCTGAGAGCAGACCCCAGGGCTGCACTGGCGCAGGCAAGTCCTCTACCCCGAGTCACTTCCCTAGCCCTTGCTTCTTGTTTCCATTCTTTGCTTAGTCTGGCTGGGCACCATCACATCCATCTTGAAAATATGTTGTGCTCTGACATCACCGTCATCAATTTCTCTTTCTTTTTTTGGGGGGTAGGGGGTGGAGATGGGGTGAATGATGACGTTCCATTCTGCAGCCCTGGTTGGCCTGGAATTCACTAGGTAGACCAAAACAGGCTGGAAACTAAGACCTCTGCCTCCGGAGTGCCGTGGGGTACCTGTGTGAGCCATGCCTGGCTTGAATTATGTTGTAAACCCAGTCAATGAAGCTCAAGGAGGAAACCTGTGCATAGGAACCTGGAGTACACAGAAACATTCCCAGCCCCCAAAACAAATCCAAGAGTTAAAACACTAAAATGACCACAGACGGCTGTGCTAGTTTGTGGGCTTCGTGATAGCAATGTCAACTGTCACTAATCTGACACATCACCTTCTGTTCCCTAGTCTCCATGCTGAGCCTGAGTGGCTGCTGCTGTCCCCCCCCAGCTTTAAGAGAACAGGCTTGGCAAGAGCCTTCCCAGGTGTCAGCACCAGCTGTGCACTTACATAGACTCAATCATCCTCTTTGTGAAGACTTCATCAAATTCCCTCTTCAAACCCGTTTTCATGGTGTCAGAAAGGACAAGACTTGGGAGGTGGCTAACATTTCTGTCACTTTCAACCTCTTCATCTTCGTCAATTATCCTAAATAATAAATTGGAGAAAGAAAAAAAAAAAATCACTCAAGGCACTGTGTGTTTCTTGTAGCAAATGAACAAACAAAATTTGAAACTAAAAGAAAAACCCACAGGTGCTGCAGCGAGAGATCATGTAAGCTACAACTCTGAGAAAAGTGGCCAAATGAGGCTGTTTTTCACCGAGAAAGGTTTGGAATAGAGTCAAGTTAGAAGAAGTGTCCAGGAAAACGGAGCTTGACACGGTCAGTAAAAGGCTTAGTCAAGCTCTATTCCATCTACCACTAAGTGTCTGTTGTTCATTCCCCATCTCCAGCACCAGGACGTGACCCCGAGCAGCCTAGGAGAGGAGAGCTGACACAGGACCACAGCACATGTGACGCGCAGTCAGTACCTGTCCTCAATCTCTTGCAGCCGCCTTCGGGCGACTTCACACTGTGGTTCTCCAGTTGTCTGATCCATTTCCTCACAGACCACATCTAGCATGCTGGGCATAGAAAGGCTGCTAGGACACGTGTTTACCCCATGACCTTCTCTTCCCTGATGTGCGCCGAGAGCCCATTCATCAGTAACTGCACCGAGTTCAGCTTCAGTCAGTCGTTTCTTTCTTACTGGACACCTAGGAGGAGGAAAGCAGCGGGAAGAGAGGGAAGGAAGAAAAGCAATCCATTATAGACGAAATGTAAGACATTTCTCTAACGAATTAAAAAAGATATATTTTTGGGACAAAGTCTCACTCTGTATCTATGTCTGGCCTCATTCAGAGTTCTGCCTGCTTCTGCCTAGAGTGCTGGGACTGAGGAGAGAGCTTACCAGGCCCAGCTAAAACTCATTTAGTTAAAAAACATCCATTTATTTTATGTTTAAGTTTCAGCCTGCATCATGTGTACTTTATGTGTGCCTGTGGAGGTCAGACGAGGTCTCAGACCCCCTGGAACTGGACTGACAGAGATATGAGCTGCCATGTAGGTGCTTGAAATGGAACCTGAGTGTTTTCTGCAAGAATAAGTGTTCTTGGGGCTGGAGAGATGGCTCAGCGGTTGAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTTGATTCCAGGCAACCACATGGTGGCTCCTGTTGGGAGCCGCCCCCACATTCGCCGTTACAAGATGGCGCTGACATCCTGTGTTCTAAGTGGTAAACAAATAATCTGCGCATGTGCCAAGGGTATTTTACGACTACTTGTACTCTGCCTTTCCCGTGAACGTCAGCTCGGCCATGGGCTGCAGCCAATCAGGGAGTGATGCGTCCTAGGCGAAATATAACGCTCCTAAAAAAGGGGACGGGGTTTTCCGCCACTCTCTCTCGCTGGCATCTCTCTGGCTCTGCGCGCCCTGCGCTCTCTCGCTGCCTAAAGATGTAAACAATAGAGCGCGCTCTGCGCTTTGGCGCGCCGGAGCTCTGGCTCCTAAAGATATAGAAGGGGCTTTCGCTTTTGGGGCTGGGGGTTTGCGCTCCTAGCTCCTGAAGATGTAAGCAATAAAGTTTTGCCGCAGAAGATTCTGGTCTGTTGTGTTCTTCCTGGCCGGGAACGCTATTAAGAGGCTCCCAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTATTCATATAAATAAATAAATCTTAAAAAAAATGTGCTCTTAACTAAGCTACCTCTCTAATCCCAATTTATTATTATTTTAATCAAATTATTAAATACAAACATTTCTATTTTTTCCTAGTTAGAAAATCATGCCTTTTCCCCTCCCCAGAAAATTTTCTTCTATTCCTTTTTTAAACAATTTATGCAGCACCTCTAAGATTTTAAACTTGTAAATTAAAAGGAAAAAAATCCATAGGAAAAATCAAATGGGACACAAAGCAATAGCAAGGATAAAGGAGGGTGGGAGAGGGGCTCGGCAGTGAGGAGCACTGCTCAGCAGTGAGGAGCACTGCTGCTCTTCCAGATTTCCAGCACCCAAATGGTAGTTTACAAAGTCGTGTAATTCTAGTTCCAGGGAATTCTATACTCTGTTCTGGCTATACACATGCATAAACACAAGCAACACCCATACACATTAAAAAAGAAAAGACAAAGAAGCAATTTCTCCCCAGTTACATTCCCTGCCTCCCCGTGGCCCCCCCCACCCCCCACCAGTGGCTGGCTATATAACTGTATTTCCCCACACCAAATACACATGATACTAAAATATGCTTCAAATACCACAAAAGCAGGTCATTAGCACAAATTTCTTGCCTTTGGCTATGTGTCCCTGAACAATAATGGGATCTACCTTTCTCTTAGTATAATACATTCCACCTGCATCTTAGATACGTTAGTACTTTTTAAAGAGACCTTAGAATTCATCAAACCCAGCTTCTTCCTTTTGGACCTATCTAGAAAGTAGAGGAAACTTGAAAGTTGAAGATTAGACCCCAGAGACCCTGATTCTCATCTCTATGCCTTTTCATTAAATCCCTTGCTTTTTCGAAAGGAAGTTAACTGTTTAAGCTCTTATATGAACGCGTATTTATTAGCACTATGATATGTCCATTGCAAGCTAAAAGCAGCACAAAGCAGTAAGACAGTTGGCTGCTGCCTTGTTTTTCCTTTTCTTTTTGACAAGTGTTCAGAGCACAGGTGTTCTCCTGCATGGCAGTTATCATGTGTAGCAACAGGACTAGACCACAGATGTATAGCCAAAAAGCTCACTCATTATTCCTACACTTCAGATTCACTAAACTGGAAGTCAAAGAAAACATAATTTCATTCGTGTCAGCACTGTGAAAATCAATAGTAAAGTCTCTGGATTATAAAATCTGACAATGCCTCTTAAACTTATATTTTCAAAAAATCAAAATCCACTCTTATGTTTGATTTAGAATTTTACCTCATTCTAGTACTAGAAATGTCTAAGAGACAGAAGCTGGAGGGTCAGAAGTTTAGGGTTGGTGTCTGCTA
D5_D3 5417017 5417086 70 CCGCCTGTCTTTGCCAAAGGCTCACTAACGCTGCCCTTCCTTCTGGGATCCCCCCCCCCCCGCGCGCCCC
G5 5412842 5412891 50 GCAAAGTATATTTATAATTTCAAAGAGCCAATCTGAACCATCACTTAGAA
U5 5416434 5416483 50 AGAAGCATATGACGCAACGGGAATGTATCAGCCCGGTGGTAAAATGAGAT
U3 5416507 5416556 50 AGAATCAAGCAAGTCTTCAAGGCCTGTGGATAGAAAGCAGCGTGTGTATG
D5 5416967 5417016 50 CTCGGAGATTAGCCAGGTTGGATAGATCATTGGTTGCTTAAGCTGTAGCG
D3 5417087 5417136 50 CAATCCTCCCACCCTCTGTATCCTTTCTGCTGTCAGTGCCCTTTTGTGCC
G3 5420541 5420590 50 ATGAAGATCAAGAATCTTTGTAAAATGATGAAAATTTACTATGTAAATGC
G5_U5 5412842 5416483 3642 GCAAAGTATATTTATAATTTCAAAGAGCCAATCTGAACCATCACTTAGAACTCTTTGAAGTTTGGCATAATTTCCAATTGCCAACTAGCAATTTTACTCATCTTTGAACACCGAGCGCCGGGCATGTGCCAAGCACGGAGTGGGAAGCAGTATCGTCAGACAGGAAGCAGGAAGCAGAGATTCTGTTTGTAATCTAGGGAACTTAACACCTGGAGTTGCTTCCAGAAAACAAACGTGCATCTGTGAGTAGTCTCAGGTTTCTCTGGGTTTAATATCTTGGTCTAAATTGCTCTCTTACTGCCAACGGGTGCCTCCTCTTCCAAATGAGCCTGGCTCTCCTCCCTGGATGACTTGGGGGACCAAGAACCAGAACCTAGATAGATCAGAGATCTAGGGTAAAACCAAACTTTGCTGGTTTAGAACAAACAAAACAAAACAAAAAACTCAAGCAACCAACAAAACAACCAGTTCTAGCCTCCTGCGTGACTTTGCCACAGGCCAAGGGATCCAGGGTAAAGCCTGGCTCTGTTTTCACAAGGAACATTTTATTTTCTCCTTATTAAAACAATACTAATGTGGGGTCTGGAGAGATGGCTCAGTGGTTAAGAACACTGACTGCTCTTCTAGAGGTTCTGAGTTCAAGTTCCAGCACCCACATGGTGGCTCACAACCATCTGAAATGGGATCCGATGCCCTCTTCTGGTGTATCTGGAGAGTGAGTGTATTCACATACATAAAATGAATAAATCTAAAAAAAAAAAAAAAAAAAAAAACCTCAAAAAAAGCAAAACCAAAACAACCTGATGCATGGGGGTGGTTGGGAGAGGGCTGGGGGTGAGGATGCTGTGTTCTCTGGTGATGAGCTGGAGGCCTTGGATGGGGCGGCAGGGAGGAGGGTAAGTCTATGGGGGTATCCCTAGCTGAGATTCCTACCAGAGGGGGATATAGAGACTGAAGTGGCCACCTCCTGTAGCCAGGCAAGACTTCTAGAGGAGAGAAGGGGACATCAATCGCCTTGCCTATAAGAAGTGCAGGGATAAAGATGGAGCAGACCAATATAGCCAACCAATGCCCGGCCCAACTTGAGATCCATCCCATGTGAGAGAGCGGATCCCTGACACTACTAATGATGCTCTGCTAAGCTTGCAGTCAGGAGCCTAGCATAACTGTCTTCCGAGAGGCTTCATCCAGTAGCAGATGGAGACAGATGCAGAGACCCACAGCTAAGCATTGAGTTGAGCTGGGAGTCTTGTGGAAGAGATGGGAATAGAACTGAGCAGTGGAAGGGGGTCAAGGATGCCCCAAGGAGACATACAGAGTCAACTAACCTGGGACCATGGGGGCTCACAGAGCCTGGGCCACTGACAAGGAAACCTACAGGAGCTGAACTTATCCCCCCCACCCCCATCTGTAGCAAACGTGCAGCCTGGTCTGTATGTGGGTCCCCTAACAAGTGGAGTGGAGCTATCTTGGTCTCTGTTCCCTGCCATTGGATCCCCTCCGCCTCCCTGGACTGCCTGGTTGGGCCTCAATGGGAGATGTTGTACCTAGTCCTGCTGAGACTAGATGTCCCAGGGTAGGGTGGTATCAAAGAGGTATTCTCTAAGGAGAAGGGGAGGGAGCAATGGGGGGGGGGGATTTGTAAGGGTGGGACTAGGAAGAGGGGGCTATGATTGGGATATAAAGTGAATAAAAAATAAATTATTGGAAATAGGAAAAGGAAAAAAAATACTAATGTAGGGGTGGCTGTGTAGGTGAAAAACGCCCAGCACCCAGGTGAAAGGTTGGCAAGGCTGAGCCTGATCGTAACCCCAGTGGCAGAGAGCAGAGACAAGCAGACCATGGAGGTGTAATGGCCAGCCAGCATAGCCTCAGGGGCAAGCTTCAAGTGCACTGACTCTTATAAGGCGGAAAGCAATAGAAGAGTACACTCTCCCCCACCCCATCCCATCCCCTGAAACCTATTTCCACCCCCTCCTCACTCCCATTCCCTAATGAAAGGAATACTAAAGTCTGGAGGTATATATAGCTCAGTGGTATCTCTAGTTCCACAGTAAAGGGGAATAGTGGAGTGCTAGAGCATTAGGTTCTGGGGTCTGGCTCCAGCACAGCAAAACAAAGACAACAGTGATAAAAGCTCATACCAGAAGAGATCAGAAATAAGAAGAAAAACGAAACCACATGTATTCTCACTATGCAGACTTTATTTACTAATCCCTTACTACATGCTAGCCAAGGCTCTAGTGTTTTCTTTTAAAGTTATTAATTTATATCAATTAATTTATATGAAATAGGGTTTGATCTATAGCCCCAGCTGGCCTAGCTAGACCTCCCTATGTAGCCCAGGCTGCTCTCAAACTGGCAATAAAGTGCTGAGATTACAAGTGAGTACTACCCTGCTACATTTAGTTTTGCAATCATCTCATTTTCTAAAGACTCATTTTGTGAAAATTTCCCAGGTGTGTGTGTGTGTCCGCTAACCCTAAGCCGGATATGCCACCAGTTCAATTTTCTGCTGTACTGGGAAGTGGGGGGGGGGGGGGGACGGGACGGGGGACGTAGCGCCGGACATTAAAATGGGGTCGGGCTAGGGTAAAACCGTGAGACTCGGTCTGGAAATCTGGCCTGAGAGGACAGCCTGGCAATCCTCAGCCGGGGTGGGGACGTCTGCCGAAGATCCTTGGACTCCAGCAACCAGTGGTCGCCACCGTCCATCCACCCTAAGGCCCAGTTTGCACGGCGGAGAACAGCTGTGCAGCCACGCTGGACACTCACCCCGCCCGAGTTGAGCCCGCCCCCGGGACTACAGGACCAATAAGTGATGAATATACCCGCGCGTCACGGAGCACCGGCCAATCGCGGACGGCCACGACCCTAGAAAGGCTGGGCGCGGCAGGAGGCCACGGGGCGGTGGCGGCGCTGGCGTAGACGTTTCCTGGCTATGGTGGTGGTGGCAGCGGCGCCGAGCGCGGCCACGGCGGCCCCCAAAGTGCTACTCTTATCTGGCCAGCCCGCCTCCGGCGGCCGGGCGCTGCCGCTCATGGTACCCGGTCCGCGGGCAGCAGGGTCGGAGGCGAGCGGGACACCGCAGGCTCGCAAGCGGCAGCGGCTCACGCACCTGAGCCCGGAGGAGAAAGCGCTGCGGAGGTGGGCCCGGCGGGCAAGGCTGGGGCGCGGGGCGGCAGGACTGGGATTGGGACTCTCTCGTGTGTGCCAGCTGGTGGGCTCCGTACGGTGGGTTAGATTCACCTCTAGTGTCTAACCTGGGAAGCGGAGCTGAGGGGGATGCCCCTCCGAAGGTCTGCGTCGGGGGTGTGTGCAGGAGCTCCCGACACAGGCACAGAAGAAGGTGCCCGACGCCCAGTCCTCTGTAAATGCTCGCTCTTTGTGGTCGTAGGGTAGGAACCGCTCCAGCTGTCATTGCAGCCACTTGGGAACCCCACCCTGGGAACCGAGTCCACAGCGTCCGGCATCCCGAGAGTTTGGCTTGGGGAGGGACAGTTGGTAGCGTCCCCGCCGCCTTCACGGATATCGCTCTAGCAAGGAGCCTGTGGGACGGAATTGGACCCAGAAAGTAGCGGGGGAGGAGGGAAGAAGCATATGACGCAACGGGAATGTATCAGCCCGGTGGTAAAATGAGAT
U3_D5 5416507 5417016 510 AGAATCAAGCAAGTCTTCAAGGCCTGTGGATAGAAAGCAGCGTGTGTATGCGTGTGCGTGTGCGTTTTGATAGGAGCTTTAAGCGTGTTTACTTGCTAAGCCTTATTCTGTAAAGTCAACGAAAGCACCAGCTGGCCACGTCTACAAATGAAGACACATGAAAGCTGGAGATGACTCAGTTATGTTCCCTGTCTCCTCCCCAAGGAAACTGAAAAACAGAGTAGCAGCGCAGACTGCTCGAGATAGAAAGAAAGCCCGGATGAGCGAGCTGGAGCAGCAAGTGGTGGATTTGGAAGAAGAGGTAAAGGGACTTCAGGCCATGCTTTCATCCCATCCATATCAGGGCCCATCCTAAACTGCTTCAGCCCTTTAGAATACAACCCAAAGTGCCATTTAAAGTTTAACCAGCCTAGCAGATAGGCCGTGAAAGCAGACGTGACTCACCCTGGCCTGCCCTCCCCTCGGAGATTAGCCAGGTTGGATAGATCATTGGTTGCTTAAGCTGTAGCG
D3_G3 5417087 5420590 3504 CAATCCTCCCACCCTCTGTATCCTTTCTGCTGTCAGTGCCCTTTTGTGCCCCTCCACCCCGGCATCCTTTTACCCTTTGGGGAGTTATTTTAGTTTCTAAGTTAAGTTTAGTTAACTTTAGCTATTTCTAGCGTTTCTAGGCATTGCCACATTTACGTCCATTTATATGCGCACGTGCGCCCTGGTTTGAGTTTGGGTCACCTCACTTTGTAATACACTTTCCAAATTTATACATTTTCCCTGCTAGTTTCCTTTCTCTATACAGGCGAGTGGTACCTCACTGTGTGTGCACCCCACTTTCACGGTTCTCTGGGCATCTGTGCTCAGCATCTAGGCTGCCACCATTTCTTTGCCATTGGACCACTACCACTTGCACCAACACTTGCCATTTCAAGACAGGATGGTGAATTATTTAAAGATTATTTTTAGATAGGGTCTTAGGTTGGCCTGTAACTCATGGCATGCCTCCTGTTTTACCATGCTGACATTACAGGCAGTGAACCACCTTGCCATACTTTTTTTTTTTAAAGGTAGTGTATTAACACAACTGTAAATTCAAGCTGCAAGTGACCTTTTTTTTTGGCTGAAATCTGCGAGTAGTACTTGTAGGCATTATGTTGTTTCTGTCACCATTGAAAACACTTTTGTTTTCTTCAGAGATTGGCCTTGAATAAACTTGCTTCTCCCGCCTCAGCCTGCTTGAGTGTTCAATGGCATTTTTGGGGGGACAGCTTGATGTCTCCCAGGCTGTGCTCTAACTTGCTGTGTAGCCAAAGATGACCCCAAATTTGTTTCTCTTGCTGCTATGTCCCAGGTGCTGGGATTACAGTTTATGCAGAGCTGAAGATGGAGCCCAGGGCTGCAAGCCTGGGAGGGCAGGCCTTCTCCCAACTCCTCTGTCCCATTAGCCACCGGTGACAGAATGGCTGTGACCCGCACCAGCAGGGAAACAGCTGGAGCAGAACTTGCAGTGGATTCTTTAGTGACGGAACCACACGGTCTAACCGCACGGCCTCTTATGTGATTCCTTACAGAACCACAAACTCCAGCTAGAAAATCAGCTTTTACGGGAGAAAACTCACGGCCTTGTGGTTGAGAACCAGGAGTTAAGAACACGCTTGGGAATGGACACGCTGGATCCTGACGAGGTTCCAGAGGTGGAGGCCAAGGTAAGTATTGGGAGACCTGGCTGCAGCACTACCTGGCTGCAGGTTTGTGTTCTGGACCTCCAATCAAATCCTTTTCTCTTTTCCTTTATGAGACAAGGTCTTAATGTCTAATTTTGGCTGGTCTTGAACTTGTGTCAGTTCTTTTGCTTCTAAGTAGTAGGACTATAAGCACCTGCCCCTGTGCCTAGCTGAGGAATCCTGAATTTTCCCTGTTTCCTTGAACTAAACTTATGATCTTCTTGCCTTAGCCTTCCAAGCGCTGGAATTACATGCATGAACAAGTGGTTTGTTTCTTGGCTTTTTTGGGGGATAGGGTGTCATGTAGTCCAGGTTGGCCTCAAACTTGCTCTGTAGCTGATAATCCTACCTCCACCTTCCAGATGTTACCATTACAGGCAGATGTTCCTTTGTGTGGTTATGTAGGTGTGTATGTGTACATGGGTGTGGGTTTATACACATCTCTGCTTACGTACAGAGGCCTAAGGAGCATATAGATGTCTTGCCCTAGCACTGTCCACCCTGCTCCTCTGCAGCAGAGTGTCTCACTGAATCTGGGGCTAGGCAGGTGGACAGCAAGCCCTGGTGAACTTCCTGTTTCTGCCTCCCTTGATGCTGAGGATTTGAACTTGGGTCTTCAGGATTGTACAGCAAGCACATTATATTCAGAGCCACCTCCCCAGTTCCTTTCGAGCCCTTTGAGGAGCAGAGACTCACAGCTACCCAGCATGTATATCCTTGGCAACTTTTACTCACTGTGGTCTTTCCTTCCAGGGGAGTGGAGTAAGGCTGGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTATGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCTCCCCAGAACATCTTCCCATGGACTCTGACACTGTTGCCTCTTCAGATTCTGAGGTAGAGCTTATTCTGTAGCCTAAGTGGCGTGTGACACGCTTAGCCAGGCAAACGGAGAAGTTAGTATTGGTGGGGTTAGGATTAAGCACTTTCCTAGTCTGCTTAAGTGGATGGAGTAGGGGGAAACTGTTCCGTGGGTGGGTCCTATGATCTGAGAGCATAAGTCTGGTGGATGGCTGGGTCCTGTGATCTGAGAGTGTAAGCCCTAAGTAACATTGTGGAACCCAGTACTAAAAGTATTTCTGGTAGACTGTCACATTCATTCTAATAGTGAACTCTTTTGTGTTTTGCCTCTTGTAGTCTGATATCCTTTTGGGCATTCTGGACAAGTTGGACCCTGTCATGTTTTTCAAATGTCCTTCCCCAGAGTCTGCTAGTCTGGAGGAACTCCCAGAGGTCTACCCAGAAGGACCTAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACCTCATCAGCCAAGCTGGAAGCCATTAATGAACTCATTCGTTTTGACCATGTATACACCAAGCCTCTAGTTTTAGAGATCCCCTCTGAGACAGAGAGTCAAACTAACGTGGTAGTGAAAATTGAGGAAGCACCTCTAAGCTCTTCAGAAGAGGATCACCCTGAATTCATTGTCTCAGTGAAGAAAGAGCCTTTGGAAGATGACTTCATCCCAGAGCTGGGCATCTCAAACCTGCTTTCATCCAGCCATTGTCTGAGACCACCTTCTTGCCTGCTGGACGCTCACAGTGACTGTGGATATGAGGGCTCCCCTTCTCCCTTCAGTGACATGTCTTCTCCACTTGGTACAGACCACTCCTGGGAGGATACTTTTGCCAATGAACTTTTCCCCCAGCTGATTAGTGTCTAAAGAGCCACATAACACTGGGCCCCTTTCCCTGACCATCACATTGCCTAGAGGATAGCATAGGCCTGTCTCTTTCGTTAAAAGCCAAAGTAGAGGCTGTCTGGCCTTAGAAGAATTCCTCTAAAGTATTTCAAATCTCATAGATGACTTCCAAGTATTGTCGTTTGACACTCAGCTGTCTAAGGTATTCAAAGGTATTCCAGTACTACAGCTTTTGAGATTCTAGTTTATCTTAAAGGTGGTAGTATACTCTAAATCGCAGGGAGGGTCATTTGACAGTTTTTTCCCAGCCTGGCTTCAAACTATGTAGCCGAGGCTAGGCAGAAACTTCTGACCCTCTTGACCCCACCTCCCAAGTGCTGGGCTTCACCAGGTGTGCACCTCCACACCTGCCCCCCCGACATGTCAGGTGGACATGGGATTCATGAATGGCCCTTAGCATTTCTTTCTCCACTCTCTGCTTCCCAGGTTTCGTAACCTGAGGGGGCTTGTTTTCCCTTATGTGCATTTTAAATGAAGATCAAGAATCTTTGTAAAATGATGAAAATTTACTATGTAAATGC
U5_15 5401435 5416483 15049 GTGGCTCACAACCATCCATAACAAGATCTGATGCCCTCTTCCGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATAAATCTTTAAAAAAAAAATATTTGGTTAAAAAACAAATAAAACAAACAAACAAACAAACAAAAAAAGCAGACCAAAATCCAAAAAACTCTTGGGCTATCAAGATGGCTCAGTGACTAAAATTACCTGTCACCAAGCCTGATCCATCCTCAGGTTGACCTTTAACCTCCACACTCACACCTGCCATATGTACAGAAACATGCTCTCCAGCACACGCACACGTGCGCGCACACACACAACTAATAAACAAATAAATGCGATGCATTTTTAGAAGAACATTCTCAAAGACACGATAAACCCCAGGCTAATACATTTTACTAATTTTTTTTTTTTCTGAGACAGGGTTTCACTATGCGGCCCTAGCTGTCCTTAACTCACTCTGTAGACCAGGCTAGCTTTGAACTCAGAAATCTGCCAGCCTCTGCCTCTCCAGTACTGGGACTAAAGGTGTGTGCCACCACCCCCTGGCTTTACTTATCTTTTAAATCTTATTTAATTTCAAGCTTTTCTTACTTTTTCAACCTTGTAAATTACACCATTTAAAAAATATAGCATAGAAAACTACAGGGTTGTATCTGTAGCTTATACACGGTTGTATCTGTAGCCTCTGTAAACACAGCTTAGTCTGTTTCTCCCCTGGCACTTTTTGCAAGATTAACATTCAAATTTTATTTCACAAGAGAAATGAATTTTATATAAGAATTTGTTCTTCATCCTCAGCTGGATCATTTAAGAAAGCTTGGGTATTTTACTCCTTTCTCCCTCCCTCCCCCAAAGGGTCTTGCTATGTAATTTAGGCTAGCCTCAACTTGAGACTATCCTCCTGCTTCAGACTCCTAAGTGCTAGGATTACATCTACCCATCTTTTTTTTTTTTTTTTTTTTTTGAAGATAAAGTGATTTTATTTGAATTTTTGACGACTATATCTTGTTGTATAAAGGGAAGAGTGAAAGATAAGAATTGACCATTTCAAGGCACATTACAACACTCAGTCATTTTAATTTAATTATTGTTTTGAATATTAACATGGTTGCCTCTACACTAAATGAAGGACTTAATAAAAGATTGTAATAGGAAGAAAGTTTTGCTATAAATGTTGTTCCTTGGTATCCCCTAGAATCTTAAGCAGGTAAATTTTGTACACATGGATTCGTCCTATCCTCTTAACTACAATGTTATTTTGTTTTTATTAGCAGCTGCATAGATAATTATTGGCAGTTCCCTTCCTTGCAAAGTTGTACAATATTTATTAATTCTACAGACCTTGCTAGTCTTCTCTAAAATGAAAGACAACTGTCTGGTAAAACAAGAAAGGTCCCTCAAGCTTCAAATCTGTTCGACATGACATTTCTTAGGAATGTATGCTAGGGACATATTTAAGGATAATTTAAGAGTTTCATTTAAAAACTACGAATTTAGAGTCTATTTCTAAACACATTATGAGGCCCAGTAATTCACAACTGAATAGTGGAAGAATATAATTTGTACAAAATAACTTGTAAATTTAGAACAAAATTTTACGTCTTTGATTTTAAAATACAGCAGTTAACTTTCCCTCAACTTCTATTATTTTCTTTTTTTTTATTTTTTTTACGTATTTTCCTCAATTACATTTCCAATGCTATCCCAAAAGTCCCCCACACCCTCCCCCCACCTACCCATCTTTTATTTAAGAGTGAATTTGGGGGCCAGTGAGATGACTCAGGGTAAGGCACTTGCTCCACGCCTGATCCGAGTTTGGTCCTTGGGACCCTCTATGGAATGGAAGAGCTGATGACCACAAGTTCTCTTGTGACCTCCACAGGAGTGCAAAGGTATAGCCACGTGCACACTGTATGCCTGTTCACACTCAGACACACAGAATTAATGGCTCTAAGTGTTTAAAAGTTCCAAGTTTGTGAGACGATAAAATGTCATCCCAACTTCCTCTCTACGTTTCTCTGGTTTTGGACAGATTCTTATTTCGAAGCCCAGGCTGGCCTTGAATTAATCTTTCTCCCTCAACTTCTGAAGTGTACCACTAAGTCCAGTCCTTTTCATCTTGATTGGTGTGTTTGGGTTAGTCCTCCTCAGTGTGATGGGCTTATTGTTTGCTTGTTTTGTTTATTTATTTGTTTGCTTGTTGCCGAAGTTGTGGCATTACCACAAGCAAAATGCACATGAAAATCGTGGTACGAAGCATGCTGAATTCTGTGCCCATTCTTCAGAACAATTTCTACACCTGACTAGCTGATTGTCAGGCGGATAGATGTAGGCAGGAACCAGAGGCAGCCGCTACCTTCAAGGTCTGCTCTGGGGATGACAGGTCGGTCTGAGCTATAGGAACAGCAGGTACAATCTGGAGGGATGCTTGCCTTGAGTTCAGAGCAGTGAGTCTTAGCGAGAGGCAAGGGATTTTGTAGGTAAAGACCCCAGACATGCTTTAAATACCTCGTGTGGCACAAAACATGGGATAACCTCCCCACAAAGAATTGTCTAGCGCCAAATGTCAATAATTCTGAGGTAGAAAAACTGACTTAAACAGAAAGAGGAAATGGGATTTGTGAGCATAATAAAAGGGAAGGAGGGGCTGGAAAGATGGCTCAAGCTGCCAAGGTGGCCACCACAGAAGCATGAGGATGGAGCCCTGTTCAAGTCTCCCGCACTCACATGACAAAGAGGCACACTGGCACACGCCTGCACACCCTGAGGAGGAGACAGCACTCACATGACAAAGAGGCACACTGGCACACACCTGCACACCCTGAGGAGGAGACAGGAAGATCCCTTGGTTTGCTGGTGAGCCAGGCTGGCCACAGTGACTCAGTGAAACCGTGAGTCCCCAAATAGGGTAAAGAGTGATAGGCAAGACCAGAAGCCAGTCTCTGGCCTTTGAACATACACTCCTGTATGAACACTTGAGTGCACACACGGGTGACCGCAAGCGCATGCACACACACACACAACCCATCTCACATGAGACAGGGCTGCAGCTGAGACAGGGATAAACAAGAAGAGTCATCAATGGTCCTAAGCTGATTATCTTTTAATCACTCACAAGAGTGACTCCTGCTAAGTGTCTCATCTTATCTCCTGGCATCAGAAAGCAGGCTACTGTGGCAGGACCAGCTACTTGCAGATGCTCTCTCTGCTCAGGGGTGGTTCCTCCCAGTGCTGGCAACCCATCCATGAGAGCAACAAAAGTCTCAGTGTTCAGAGAGGCCATCCCAGGCAGTGGGGAAAGCAGGGATCATGCTTTCTGATATGTCATGGGAACCCGGCTGCCCTGGTATTTACAGTTCTTGCATAACTGTGCATGTGGGAGTGCTCAGTCCTGGGTAGAAGGCCATGCTCTGAAGCCATGAGGTAGCCAGGCTCTTTCTCACATCTTTAGCATACATGAGCTTGCTTTCCTCATACTTGCAGAATGGCCACTGAGACCCTCTCCAGTTTTGGAACTAGGTCAACTTTCCAGGCAGGATGAGAGGAAAGGAAGTGAAGTCAATAGGTAAGAGGTGAAAGGCTCCCAGCGAAGTCCTCACCACTGAATAAACTTCCTGGAATCCTCTACGCCTCCGAACTTCTGCTGACACATTGGTTCAAACTGTACCACACGGCCATCTTCAGTTTCACGAGAATCTGGAAGCTGTGTGTTTTCAAGTAGGCTCTTTGAACAAAATAGACAGGAAAAAAACAGAGCAGATAGACACTCCGCAGGCTGCCAAATGAGCGTTTCCAGCCCTTCTGTGTCCACGATGAGACAGCCTGCCTCTGAGTTCTGCCTTCATGAGAATGGTGGAAGACAGTCTTCAGCATCGGACCAATGTTCTGCCATTTAAAGTCTATTGCAGGCTAGGTGTGGTGGAGCATGCTTGAAATCCCAACTGGGGGGAAAGCCAAAAGGATTGTGAATTTGAGGCCAGTAAGCCATGCTCCTCAGAGAAATGAATGAATGACAGAAAGGAAAGAGCACGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAGGGAGGGACGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAAGGAACTCTTAGGAAATCTGGCAATTCAATTGCTGTCCAAAGGTCCTGAGTGGACTTGGCAGTTGAGAGTGTGCATTGCAGGGACTCTGGCCATCCTGCACATGGTGAGCATGGCTCTGCAGCCTCACCCTTCTCCCTCCATTCCTTCTGCCTTGCTAAAAACCATTAGATGACATTCCTAAAGCTAGCCACAAGGTCTATTCCCTTATTTGCCCACTTTCTCTTCCTGAGGCTGACTACCCCCAGGCCCAACTATCAAAGTATTGAAGTCTGGCAATCAAAAGCCCCCTTTGATTCAGCAAATTAACATGCCTAATCAAAATACACCATGGCATCCTAGTCCAATCAAAATATCCCACCGCATCCTAGCCTGTTCTAATACATCACCACATCCTAGCCTGTTCTAATACATCACCGCATCCTAGCCTGTTCTAATACATCACCTCATCCTAGCCTGTTCTAATACATCACCACATCCTAGCCCGTTCTAACGCAGACCTCCCTTTTGTCTTCAAAATGACATTTGCAAGGTCCTTTGCTGCTGTTTTTTTTTTTTTTTTTGCCTGAGTCAGAAGGCAGCCACTTTAATTTTTCTTCCCTGCTTAATAGAGGAAAACGGATGTCTGGGTGTGGTTTGTGTCTAATCCGGGGTCCAAAAAGGAACCCCCAGTGTGCGGAGGTCTCCTTCATGCTTAGCATGCACATGGTCAGAGGTTGGTGTCCGAGCACAGTGACGACGATGACGATGATGAAATCATTGGTACTGTAATAAACAGAAACTGTCTTCTAAGAAGAAACTATAATTCACTTCTTATTTTCTACTACTCAGCCATCTTGCTGGTTCTTTTGTTTTGTAAATGTAGTGTATAGCCCAGAATGACTTTGAAATCATAACCTAGCCAAGGATGGCCTTGAACTCTGATCTTCCTGCCTCCACCTCCCGATTGCTGAAGGCCTGTGCCACCATATCCAGATTATTCACACTTATTTACTTATTTGCTATTTTATTTCATGTGTATGAGTGTTTTGCCCTCATGTCTGTCTGTGCACTACTGGCGTGCCTCGTACCTGTGGAGGACAGGAGATGCCATCAGCTCCCCCAGAAGTGGAATTACAGGCAGCTGTGAGCTGCTGCGTGGGTGTTGGGAATCAAACCCAGTTCCTCTAGCAGAGCAGCCTGGTCTCTAAAGCACTCACTCATAGCTTCAATGGTTGCATTCATTTTTAAATAGTTTTATATTTGGATTTGTTTACTAGTTTATTTCATGTCTTCTAATTATTCATTTTTTTGTGTGTTTTTCTTTTAAATTTTTAAAAATGTTGTGTGTGTGCACACATGTGTGCATTTGGTGCTAGGCAGAGCCAGGGCTTTGTGTTAAGTGAAGCCTTCCCTGAGCTGTGGGCCCTTTTGCCTCTGTTCTATGGAATAGTTTCTCTAGTTCTCTGCCTTCCGGTGCCCCAGTCTCTCATTTTTGTTAAGTTTCGTTCCCAGTGTTTAGTTCTGCTTTTCTAGTACAGTGCTCTCAAATGTTTTAGTTCTCACTGTCACTAAAACAATGTAGCACCATCCTATATCCCTGACAAGAATCCTTTGCTTGTAATCTGGGTCCAACGCCTCGCTAGGCCTGGGTGGGCACTTCTTACGGAATCCAGCTGCAGTACCAATGCTTGTCTGTCACGCTACGGGAACTCAGGACTTGGATATCTGCTCACCTCCAACTTGTGGCTGGCCACCTGACCTGCCTGCAGTCACACAGCCTGCTTGGTCGGTTTAGCCAGGATCTCCTTCACGTTTGAAGCTTCCTCTTAGTAATTTTCCATCCACTGGCTTCTCCCCGCTTTTGCGCTGGAAAGCCCGGCTTGGCCATGCTGGGTCTAGACCCACTCTGCCTCCCAGAATCTATTGTTCGACCTCCAGCTACAGGGAATAAAGTCTGACAAGATGTCTTAAACAAACAGCACAAGACATGTTTTCTTCAACACCCCTTAGCTTGTTGTAAACGTGAACATTTCCAAGGATGTTGTTTCATTTTTTAAAATTAAAAATAAGTCGTCGGTGCTGGGGTCCAAGCCACAGCTTGAACATGCTGAGTGCACACTTTTATGACAGTGACAGTTGTAGTCTCAGGCCCGACATAGTAGGTCTCCCCTTCCTCATCCTGGCCTCCACCCTCCTCCTTGTTTTCATTCTCCCTCTCGCTTTCTTTTGTGTTACATAAGACATAGTCTTTTTTTTGTGTTACATAAGACATAGTCTTATGTAGCCTAGGCTAGCCTCAAACTCACTCTGTAGCTGAGAATGACCTTGAACTCTTGATCTCCCCGCTCCCACTTCCTGAACGCCAGGGTTCACGGGCAGGGTTCACAGGCACGGCACAGCAGGGCAGTTTGGCGGGGACTGAGAAGTGAGCCCACCACAGGCGGCGGCCCTTTACCAGCTGAGCTCCTGGTTCCTCTCTGCCCCCTCTCTCCCTGCTTTGTGTTTCTCCAACTTAGGGCCTCAAAGGTATTACACAAATATTCTGTAAGCTTTAACTCCAGATTTATCATATAACACCTCCGTGTGGGATTTCACTTATCTTTACTGCTAATTTAATTGTAAACTTTCCTTACTCTTTCAACTCCGCGGTGAAGTGCATCCTTTGAGGACTCTGGCTGAGAAAGCCACTCAGGGTCATATATGTAGCCATTGTAAAAAACCCTCTAGAGCAGTCACACCCATGTCTTTCCTAATAAACTCACCAACTTTTGCCTTGCTCCAGCTCACCCTGAAATACTTTCCCATAGCATCACCAAGGGTTTCCCTGAGGGCTGGACCTGAAGCAGGAGAGAGTCCCCAGGCGGGTAGAGGCTGTGTTGAGCTGTGTCTGCCTGCTACACATGGTACTAAGAACATGAAACCCATAACCCTAGTAAAGCAAAGAGAGTCCATCCATTTCTCGAGGCCACGAAACTCTACCCAGGCTGGTCTTGAACTCACAGAGATCCGCCTGCCTCTGTCTCTCTTGTGATGGGTGGGACTAAAACCTTGCCCACCACTGTTCAGCATCCATTCCAATTTAAATGACTAAAGTTTGTAATAAAAGTTTAAAAACAAATAAAACTCTTATTACTCTTTTAAACCGGCTCAGTGAATGAGTGTATGGAGCATAGACGCTAAGTACGCCCTCATCAGATGATGTGATGATGGACCAAGGCTCAGTGGGACGTGGGCTTGCCCAGTCTGATTGGAATCCAAGCACTGGGGGTGGGAGTGGGGGCGGGCAGAGACAGGCAGAGCTCTGTAGCCCAGTGGCCAGCCAGCCTAGAGGAGAAAGTGGGCTGCAGGCTCAGTGATGGACCCTGTCTCCAAAACATTGGGTGGAAAGTGACAGAGGAAGACACCTGACATCAGCCTCTGGCCTCTGTAACACATTAATGGGCACACGTGCACACCCCAACCCCACACTAATGGGCATGCGCACCCCACTCCCACACACAGATGAATAGCTGCTCACACTGTCAACCCACACACATACCTGTGTGCGAGGGTTCACACATTCTGAGGCTGAACTCTCGCTTTTAATAGATAGATTACATACATACATGTACAAACATTAGTATTTATTTAGCAAATAAGGCCATTCAGGTTAAGGAGTGCTTGTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTCTCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCTCTCCCCTCCCCACCCTCCCTCTCTGTTCTCACTGCTAGAGAACAGAGTTAAGGACAGAAAAGAATGGGGGAGCTGGAGAGATGGCTTGGCAGTTAAGAACACACCCTGCTTCTGTAGAGTTTGGTCCCCAGTGCCCAGGGTAGGCAGCTCACAACTGCAATTCTAGCTCCAGGGGCTTCTAAACCTCTGGTCTCTAGAGCACCAACATGTGTGTGCATATACCCAAACACATATATAATAAAAAAAAAATCTGAAGGGAGAGGGTAAGAATACACCTTTTGAGCTGACACAGTGGGACAGGCACTCAAGGGGCGGGGTGGGACCACCAGAGCCACATAGTGAGACCCTGTCTCAATATACATATATACTTTTTGGTGTCAAGTTAGAATTGGAGTTATTAGAACTCAGTGTTTTTAAATATATAATGCTGATCAACACGGAAGCAAATGTAGTTATCGACATCTTGTTATAGCTATTGGTATGCAGATAGTACATGCGCCTATAGTTCTTGATTCTGGATACTAAAAAAATGTAGAAACAGTGAGACCCCACCAGCACTGTTAAATAAGTGAGTGTGTAAAATAAACGATAAAAAGAAGCAGTAAATTCCAGCAACAACAAACAAGCTTAGTGCCAGATCTTGGTCACTAAATAACATTCACCATTTTTTCTTAAATGGGAGAAAGTGCATACACATTTTATCACATGCCTAAGGCGCTGGAGTGTGAGGTCACTCTTTAAAGATGTGAGGTTTATTCCTCATCACTGCCAAAAACGACAGGCAGACAGACAGACATAAAACAAAATAGAGCATGGTGGTACATGCCTGTGATCCCAGCAATGAGAGGCTGAGGCAAGACATTCACTACAGGTTTGAGGCCAGCCTGGGCTACATATTGAGCTCCAGGACAGCCTGGTTACATAGCAAAATCTTGTCTCATAAAGACAGAAAAAGGGCCTGGAGCGATGGTGCGGCGGTTAGGAGAACTTCCTGCTATAGTTTAGTTCCCAGCACCCAACAGCAGCTCACGTTCATCTGTAACTCAAGTTCCCGGGGATTACCAGACATGCATGTGCTGTACAGACATACATATAGGACAAACACCCGTAAGCATTAAAAAACAAAATAAGGGAAAACAAAAAATTAAAATGGGAAGACAGAAGAATGGGGAGATCATTTGGGCCAGGCATAGCTCAGTAGCAGAGAGCTTCCCCGGGAATGTGCAAAGCCCCACGTTCCATCCCCAGAGCTTGCACAAAGGCTGATTGCAAGGCTAGATCTGGACTAAGAACAGAGGGAGGTGGCTCAGTGGGTAAGAGCCTGGCTGCTCTTGCAGAGAACCTCTGTCCAGTTCCCTGCACCCACACTGCAGCGCACAACTCTCTGTGACTCTTGTTCCAGGAGATCTGTTGCACTCGTCTGGCTTTGGAAGGCAGCAGGAACACAGACACGCATGCAGACAAAGCACCCATACACATAAATAACAACAACAATGAAAAAATTAAAAGAGATTTCCTGAAAAAAAAAAAAACCAAATATGTTAAACAATATCAAAAATGGTCAAAACCTGAGGGAGAGAGCAGGCGCTGTGGCTGAGTAGTAGGACAATTGCTGGGTATGTACAAGAGCCCGGGTTTCATCCCAGCACGGGGGAGAGAGTTATAGGGACAGATCAAAAGGAATGCTTTGAGTTAGGTCTGGAAAGATGGTTCAGTGATTAAACGCACTTCTGAGTCTTCTAGAGGACTCAGATTCAGTTCTCAACACATAAGCGACTGCTCACAACCACCTGCAACTCTAGCTCTTGGGGATCTGATGCCAAACTGCATGCATGCGGTGCACAAACACACGAGCAGGCAGAACACTCATACACATAAAAGTACCAACCGAGACCCCTGAGGCAGGGGGATTTCTGAGTCCAGGATGGTTTACAAAGCCACTTCAGGTCAGTCTTAGGTACACAGTGAGACCTTGTATCAAATAAATAAAATTTACAAAATAAAAATAAGTAAAAAGATATTTGTAAATTTAAATTTTAATGAAAATAAACGATGATGATAAACACCAAATGTGAAGAAGGGGCTTCCAGCACCTGGGAGATCCAAGCTTTGTCAGGACCTGTGACATGGCAATGTTCTTCCAATGCGTTAGAATTATGAGTTAGAGTCACCTAGTGATCCATCCGCAAAGCGTACAATTCAGCGTTGTCTTCCATGAGCCTCTTTAAGATGGCAGACGTGCACGTGACCCGGAAGGAACGGGCTCAGTAGTGAGGTCGTCTCCTGTCTCATCTCCATCACCACCAGCTACGAGCTCTCTGAACGGAGCATCTTCTACCTGAGGATGCAGGTCCTGAGATCTCAGCCCGGGTGAGGTGAGGTCTTCCCTTGAAGGGTGCTTGAACTGGCTTTGTGAGAGAGTGGAAACATTGCTTCCAAGGTACCGTTCCAGGCATCCGGCTCTTGGGAAGAGTCTCTGCAGGCGCCCCTGTACCTGCCCTGTGTAGAGGGTTCCTACACCCTTGGTTTAGTTCTAGAAACAGGCTCTCTCTATGTGGTGCAGGCCTGGACTCCTTGGAGCAAGTGATCTTCCAGCCTCAGTTTCCACAGTAGCCATGCCACCTGTCTGAAATCTTGTTCCAAAAGCACTACTTAAGGCAGTGAAATGTATCTATATATATGATAAAATTACAAACAACACATTTATTTATGTAAATAGTGTCTGGAATTAACCTGCCTTGGCCTCCTGAGTGCTGCGATTAAAGGCATGCACCACCACTACCTGGCTTTGATTTGGTTTTTTAATCACAGGAACATATAGACAATTTAGCATTTTCAGCATCTCTAAGCCTACAGCTTGGTGGCATTAGCTACTTTACAGTGTGCAGGCGAGTGTCCTCTAAGCAGCCACATCTCCGGCGCTTTGTGGCTTGTCTAAGATCTCCTAAGAGACAGTGTCTCTTCTGTGGGTTCAGACCATCGACCCCCCGCCCCTTTTCTTTGATTTGTCTTTTGACTCTGTATTTTGCTTGCTTGTCACTGCTTCTTACATGTCACAGAAGCTAGGGACTTTGTAGTTTATCTAGCTTCTATCAGTTGCGTCTTGTGGATGTTTTAAGACAGTAATGGAATCTGATGCAAGACTTATCTACTTAATCTTGGACAGAGGATATGAAACCATTCAAGTGTCTGCTCTTATTGTTGAAGATTTCATGAGCAGCAGTTTGCAGCCGGTCAAGTTATTGCTTTCAATATGATTTGAAATTGTTTGCCGGAGAGATAAAAAGCCTGGAAAAATATACAAAGGAATGAAAAGTCAACATTCCACTTCTATCCCCGTAACCAAGACCAAAACAGAAGCCGATAAATGCTCTCCCTACCCCCCACTCCCCTGCATCTTGGGCTTTGTCCATCCCACACGAGGAACTGTATTAAAGGGTCGCAGCGTTAGGAAGGGTGAGAAGCATTGCTTTCAAGGGCGGATGAAAAGAGTTTTCCTCCCTGGCAAAGTATATTTATAATTTCAAAGAGCCAATCTGAACCATCACTTAGAACTCTTTGAAGTTTGGCATAATTTCCAATTGCCAACTAGCAATTTTACTCATCTTTGAACACCGAGCGCCGGGCATGTGCCAAGCACGGAGTGGGAAGCAGTATCGTCAGACAGGAAGCAGGAAGCAGAGATTCTGTTTGTAATCTAGGGAACTTAACACCTGGAGTTGCTTCCAGAAAACAAACGTGCATCTGTGAGTAGTCTCAGGTTTCTCTGGGTTTAATATCTTGGTCTAAATTGCTCTCTTACTGCCAACGGGTGCCTCCTCTTCCAAATGAGCCTGGCTCTCCTCCCTGGATGACTTGGGGGACCAAGAACCAGAACCTAGATAGATCAGAGATCTAGGGTAAAACCAAACTTTGCTGGTTTAGAACAAACAAAACAAAACAAAAAACTCAAGCAACCAACAAAACAACCAGTTCTAGCCTCCTGCGTGACTTTGCCACAGGCCAAGGGATCCAGGGTAAAGCCTGGCTCTGTTTTCACAAGGAACATTTTATTTTCTCCTTATTAAAACAATACTAATGTGGGGTCTGGAGAGATGGCTCAGTGGTTAAGAACACTGACTGCTCTTCTAGAGGTTCTGAGTTCAAGTTCCAGCACCCACATGGTGGCTCACAACCATCTGAAATGGGATCCGATGCCCTCTTCTGGTGTATCTGGAGAGTGAGTGTATTCACATACATAAAATGAATAAATCTAAAAAAAAAAAAAAAAAAAAAAACCTCAAAAAAAGCAAAACCAAAACAACCTGATGCATGGGGGTGGTTGGGAGAGGGCTGGGGGTGAGGATGCTGTGTTCTCTGGTGATGAGCTGGAGGCCTTGGATGGGGCGGCAGGGAGGAGGGTAAGTCTATGGGGGTATCCCTAGCTGAGATTCCTACCAGAGGGGGATATAGAGACTGAAGTGGCCACCTCCTGTAGCCAGGCAAGACTTCTAGAGGAGAGAAGGGGACATCAATCGCCTTGCCTATAAGAAGTGCAGGGATAAAGATGGAGCAGACCAATATAGCCAACCAATGCCCGGCCCAACTTGAGATCCATCCCATGTGAGAGAGCGGATCCCTGACACTACTAATGATGCTCTGCTAAGCTTGCAGTCAGGAGCCTAGCATAACTGTCTTCCGAGAGGCTTCATCCAGTAGCAGATGGAGACAGATGCAGAGACCCACAGCTAAGCATTGAGTTGAGCTGGGAGTCTTGTGGAAGAGATGGGAATAGAACTGAGCAGTGGAAGGGGGTCAAGGATGCCCCAAGGAGACATACAGAGTCAACTAACCTGGGACCATGGGGGCTCACAGAGCCTGGGCCACTGACAAGGAAACCTACAGGAGCTGAACTTATCCCCCCCACCCCCATCTGTAGCAAACGTGCAGCCTGGTCTGTATGTGGGTCCCCTAACAAGTGGAGTGGAGCTATCTTGGTCTCTGTTCCCTGCCATTGGATCCCCTCCGCCTCCCTGGACTGCCTGGTTGGGCCTCAATGGGAGATGTTGTACCTAGTCCTGCTGAGACTAGATGTCCCAGGGTAGGGTGGTATCAAAGAGGTATTCTCTAAGGAGAAGGGGAGGGAGCAATGGGGGGGGGGGATTTGTAAGGGTGGGACTAGGAAGAGGGGGCTATGATTGGGATATAAAGTGAATAAAAAATAAATTATTGGAAATAGGAAAAGGAAAAAAAATACTAATGTAGGGGTGGCTGTGTAGGTGAAAAACGCCCAGCACCCAGGTGAAAGGTTGGCAAGGCTGAGCCTGATCGTAACCCCAGTGGCAGAGAGCAGAGACAAGCAGACCATGGAGGTGTAATGGCCAGCCAGCATAGCCTCAGGGGCAAGCTTCAAGTGCACTGACTCTTATAAGGCGGAAAGCAATAGAAGAGTACACTCTCCCCCACCCCATCCCATCCCCTGAAACCTATTTCCACCCCCTCCTCACTCCCATTCCCTAATGAAAGGAATACTAAAGTCTGGAGGTATATATAGCTCAGTGGTATCTCTAGTTCCACAGTAAAGGGGAATAGTGGAGTGCTAGAGCATTAGGTTCTGGGGTCTGGCTCCAGCACAGCAAAACAAAGACAACAGTGATAAAAGCTCATACCAGAAGAGATCAGAAATAAGAAGAAAAACGAAACCACATGTATTCTCACTATGCAGACTTTATTTACTAATCCCTTACTACATGCTAGCCAAGGCTCTAGTGTTTTCTTTTAAAGTTATTAATTTATATCAATTAATTTATATGAAATAGGGTTTGATCTATAGCCCCAGCTGGCCTAGCTAGACCTCCCTATGTAGCCCAGGCTGCTCTCAAACTGGCAATAAAGTGCTGAGATTACAAGTGAGTACTACCCTGCTACATTTAGTTTTGCAATCATCTCATTTTCTAAAGACTCATTTTGTGAAAATTTCCCAGGTGTGTGTGTGTGTCCGCTAACCCTAAGCCGGATATGCCACCAGTTCAATTTTCTGCTGTACTGGGAAGTGGGGGGGGGGGGGGGACGGGACGGGGGACGTAGCGCCGGACATTAAAATGGGGTCGGGCTAGGGTAAAACCGTGAGACTCGGTCTGGAAATCTGGCCTGAGAGGACAGCCTGGCAATCCTCAGCCGGGGTGGGGACGTCTGCCGAAGATCCTTGGACTCCAGCAACCAGTGGTCGCCACCGTCCATCCACCCTAAGGCCCAGTTTGCACGGCGGAGAACAGCTGTGCAGCCACGCTGGACACTCACCCCGCCCGAGTTGAGCCCGCCCCCGGGACTACAGGACCAATAAGTGATGAATATACCCGCGCGTCACGGAGCACCGGCCAATCGCGGACGGCCACGACCCTAGAAAGGCTGGGCGCGGCAGGAGGCCACGGGGCGGTGGCGGCGCTGGCGTAGACGTTTCCTGGCTATGGTGGTGGTGGCAGCGGCGCCGAGCGCGGCCACGGCGGCCCCCAAAGTGCTACTCTTATCTGGCCAGCCCGCCTCCGGCGGCCGGGCGCTGCCGCTCATGGTACCCGGTCCGCGGGCAGCAGGGTCGGAGGCGAGCGGGACACCGCAGGCTCGCAAGCGGCAGCGGCTCACGCACCTGAGCCCGGAGGAGAAAGCGCTGCGGAGGTGGGCCCGGCGGGCAAGGCTGGGGCGCGGGGCGGCAGGACTGGGATTGGGACTCTCTCGTGTGTGCCAGCTGGTGGGCTCCGTACGGTGGGTTAGATTCACCTCTAGTGTCTAACCTGGGAAGCGGAGCTGAGGGGGATGCCCCTCCGAAGGTCTGCGTCGGGGGTGTGTGCAGGAGCTCCCGACACAGGCACAGAAGAAGGTGCCCGACGCCCAGTCCTCTGTAAATGCTCGCTCTTTGTGGTCGTAGGGTAGGAACCGCTCCAGCTGTCATTGCAGCCACTTGGGAACCCCACCCTGGGAACCGAGTCCACAGCGTCCGGCATCCCGAGAGTTTGGCTTGGGGAGGGACAGTTGGTAGCGTCCCCGCCGCCTTCACGGATATCGCTCTAGCAAGGAGCCTGTGGGACGGAATTGGACCCAGAAAGTAGCGGGGGAGGAGGGAAGAAGCATATGACGCAACGGGAATGTATCAGCCCGGTGGTAAAATGAGAT
D3_15 5417087 5432137 15051 CAATCCTCCCACCCTCTGTATCCTTTCTGCTGTCAGTGCCCTTTTGTGCCCCTCCACCCCGGCATCCTTTTACCCTTTGGGGAGTTATTTTAGTTTCTAAGTTAAGTTTAGTTAACTTTAGCTATTTCTAGCGTTTCTAGGCATTGCCACATTTACGTCCATTTATATGCGCACGTGCGCCCTGGTTTGAGTTTGGGTCACCTCACTTTGTAATACACTTTCCAAATTTATACATTTTCCCTGCTAGTTTCCTTTCTCTATACAGGCGAGTGGTACCTCACTGTGTGTGCACCCCACTTTCACGGTTCTCTGGGCATCTGTGCTCAGCATCTAGGCTGCCACCATTTCTTTGCCATTGGACCACTACCACTTGCACCAACACTTGCCATTTCAAGACAGGATGGTGAATTATTTAAAGATTATTTTTAGATAGGGTCTTAGGTTGGCCTGTAACTCATGGCATGCCTCCTGTTTTACCATGCTGACATTACAGGCAGTGAACCACCTTGCCATACTTTTTTTTTTTAAAGGTAGTGTATTAACACAACTGTAAATTCAAGCTGCAAGTGACCTTTTTTTTTGGCTGAAATCTGCGAGTAGTACTTGTAGGCATTATGTTGTTTCTGTCACCATTGAAAACACTTTTGTTTTCTTCAGAGATTGGCCTTGAATAAACTTGCTTCTCCCGCCTCAGCCTGCTTGAGTGTTCAATGGCATTTTTGGGGGGACAGCTTGATGTCTCCCAGGCTGTGCTCTAACTTGCTGTGTAGCCAAAGATGACCCCAAATTTGTTTCTCTTGCTGCTATGTCCCAGGTGCTGGGATTACAGTTTATGCAGAGCTGAAGATGGAGCCCAGGGCTGCAAGCCTGGGAGGGCAGGCCTTCTCCCAACTCCTCTGTCCCATTAGCCACCGGTGACAGAATGGCTGTGACCCGCACCAGCAGGGAAACAGCTGGAGCAGAACTTGCAGTGGATTCTTTAGTGACGGAACCACACGGTCTAACCGCACGGCCTCTTATGTGATTCCTTACAGAACCACAAACTCCAGCTAGAAAATCAGCTTTTACGGGAGAAAACTCACGGCCTTGTGGTTGAGAACCAGGAGTTAAGAACACGCTTGGGAATGGACACGCTGGATCCTGACGAGGTTCCAGAGGTGGAGGCCAAGGTAAGTATTGGGAGACCTGGCTGCAGCACTACCTGGCTGCAGGTTTGTGTTCTGGACCTCCAATCAAATCCTTTTCTCTTTTCCTTTATGAGACAAGGTCTTAATGTCTAATTTTGGCTGGTCTTGAACTTGTGTCAGTTCTTTTGCTTCTAAGTAGTAGGACTATAAGCACCTGCCCCTGTGCCTAGCTGAGGAATCCTGAATTTTCCCTGTTTCCTTGAACTAAACTTATGATCTTCTTGCCTTAGCCTTCCAAGCGCTGGAATTACATGCATGAACAAGTGGTTTGTTTCTTGGCTTTTTTGGGGGATAGGGTGTCATGTAGTCCAGGTTGGCCTCAAACTTGCTCTGTAGCTGATAATCCTACCTCCACCTTCCAGATGTTACCATTACAGGCAGATGTTCCTTTGTGTGGTTATGTAGGTGTGTATGTGTACATGGGTGTGGGTTTATACACATCTCTGCTTACGTACAGAGGCCTAAGGAGCATATAGATGTCTTGCCCTAGCACTGTCCACCCTGCTCCTCTGCAGCAGAGTGTCTCACTGAATCTGGGGCTAGGCAGGTGGACAGCAAGCCCTGGTGAACTTCCTGTTTCTGCCTCCCTTGATGCTGAGGATTTGAACTTGGGTCTTCAGGATTGTACAGCAAGCACATTATATTCAGAGCCACCTCCCCAGTTCCTTTCGAGCCCTTTGAGGAGCAGAGACTCACAGCTACCCAGCATGTATATCCTTGGCAACTTTTACTCACTGTGGTCTTTCCTTCCAGGGGAGTGGAGTAAGGCTGGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTATGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCTCCCCAGAACATCTTCCCATGGACTCTGACACTGTTGCCTCTTCAGATTCTGAGGTAGAGCTTATTCTGTAGCCTAAGTGGCGTGTGACACGCTTAGCCAGGCAAACGGAGAAGTTAGTATTGGTGGGGTTAGGATTAAGCACTTTCCTAGTCTGCTTAAGTGGATGGAGTAGGGGGAAACTGTTCCGTGGGTGGGTCCTATGATCTGAGAGCATAAGTCTGGTGGATGGCTGGGTCCTGTGATCTGAGAGTGTAAGCCCTAAGTAACATTGTGGAACCCAGTACTAAAAGTATTTCTGGTAGACTGTCACATTCATTCTAATAGTGAACTCTTTTGTGTTTTGCCTCTTGTAGTCTGATATCCTTTTGGGCATTCTGGACAAGTTGGACCCTGTCATGTTTTTCAAATGTCCTTCCCCAGAGTCTGCTAGTCTGGAGGAACTCCCAGAGGTCTACCCAGAAGGACCTAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACCTCATCAGCCAAGCTGGAAGCCATTAATGAACTCATTCGTTTTGACCATGTATACACCAAGCCTCTAGTTTTAGAGATCCCCTCTGAGACAGAGAGTCAAACTAACGTGGTAGTGAAAATTGAGGAAGCACCTCTAAGCTCTTCAGAAGAGGATCACCCTGAATTCATTGTCTCAGTGAAGAAAGAGCCTTTGGAAGATGACTTCATCCCAGAGCTGGGCATCTCAAACCTGCTTTCATCCAGCCATTGTCTGAGACCACCTTCTTGCCTGCTGGACGCTCACAGTGACTGTGGATATGAGGGCTCCCCTTCTCCCTTCAGTGACATGTCTTCTCCACTTGGTACAGACCACTCCTGGGAGGATACTTTTGCCAATGAACTTTTCCCCCAGCTGATTAGTGTCTAAAGAGCCACATAACACTGGGCCCCTTTCCCTGACCATCACATTGCCTAGAGGATAGCATAGGCCTGTCTCTTTCGTTAAAAGCCAAAGTAGAGGCTGTCTGGCCTTAGAAGAATTCCTCTAAAGTATTTCAAATCTCATAGATGACTTCCAAGTATTGTCGTTTGACACTCAGCTGTCTAAGGTATTCAAAGGTATTCCAGTACTACAGCTTTTGAGATTCTAGTTTATCTTAAAGGTGGTAGTATACTCTAAATCGCAGGGAGGGTCATTTGACAGTTTTTTCCCAGCCTGGCTTCAAACTATGTAGCCGAGGCTAGGCAGAAACTTCTGACCCTCTTGACCCCACCTCCCAAGTGCTGGGCTTCACCAGGTGTGCACCTCCACACCTGCCCCCCCGACATGTCAGGTGGACATGGGATTCATGAATGGCCCTTAGCATTTCTTTCTCCACTCTCTGCTTCCCAGGTTTCGTAACCTGAGGGGGCTTGTTTTCCCTTATGTGCATTTTAAATGAAGATCAAGAATCTTTGTAAAATGATGAAAATTTACTATGTAAATGCTTGATGGATCTTCTTGCTAGTGTAGCTTCTAGAAGGTGCTTTCTCCATTTATTTAAAACTACCCTTGCAATTAAAAAAAAAGCAACACAGCGTCCTGTTCTGTGATTTCTAGGGCTGTTGTAATTTCTCTTTATTGTTGGCTAAAGGAGTAATTTATCCAACTAAAGTGAGCATACCACTTTTTAAAGTCACTGAAAGCTTTTTCTTCAGGCCAGTTGGCCAATATCAGTTACTAAGTGGCAGAGATAGAACCTAACCACCTTTTGGGGGTGGGGTGGGGATTAAACCTAAGATGTGCATAATGGGCAAGTTACATAAGTTGTACCACTGAGTCTCAGCTCTTTAAATTACTGTTTTGCTATGATAGGAAGTATCAGACTTCACCCTGATTTTACCTCTGGACACTTTTGAGCTGTGTAACTGAGGGGACAGGTAACTATAACTTTGAAAGGAGGATTCTAGAGTGTCTCGCAGCTGAACATCTGCCACCACCTGTGCTCTGGAAAGTTCAGTTTTTTTTTCTCCTGACCCACTTTGGAAAGGTTTTAATCCCTCATTGAATCTTAAGTGTAGGCTAGGGGTATCTTGTCTAGCATGCATGAAGCCTCGGTTCCATCTCTGGAATGGAAACAAGCAAATTTATTCAGAAAGAAATCAACTACAAAACTTCAAAGACAATGACAACATCTTCATTGTGTATTCTGCCCGGGCAAAGAACTTCATTTTTCACTGATAGAGGCAGATTAACAATTTAGCATTTACATATATCTTCCCTATCAACATTACTTTGGGGTGATCAAAGTGAACCTACAGATAGAATTCTGAGAGTCTAGTCAGTAGGTCCAAGCAGGCAAAGAATACAAGCTCGTGTTGACAGCTGTGATAGGAAGGGTTTCCATGCGCACACCCCAGGGCAGGGACCTGGTTGGTAAGTCCACAGCTCAATCCAGTGTTTTACAACACAAGTTCACTTAGGCCAAGTTCCAGTGTTGTGACTGAAAGCTATCTCATGAATACCTGAGGACCAATAATCTATTTAGGGACTATAAGGCAGATATTATTTGCCACCATTCACAGAATATAGGTATTTCTAAGTTAAAACTCAAGTCATTTACATTTAATAGCATTGCATTGAAGTGGCTGCTATACTACCAGGATAGGTCTGTGTAGATTTTCAGGGTTTCATTTCCTGTACAGATGGACAAAAAGGATAGACTGATCAGCTTTGAGAAAGCACCTGGTTTTCAAGAACATTTTCATACCGAAACACCAAGCTGCCTGGCTAGATCCAAAAGTCAACCTTTTTACTCTGTGAAACCAAATACTCTAGTAATAATGTGTTATTCCAAAGTTCAGACTAAAGGTACACGCAGTGGCTGCAGACAACATCCCTGAGCCTCACAACAGCTAGGCATCTGCCTCATTGCTTTTCTATCAGATGAGCTGCTGGAGCTAGACAGCAGTCACGCGGCCTACTCGAGTATTCCAAGCATCAATTCAATTCTTGTCTCCTAGAAACTCAAAAACTCAAGTGTTATTTTTCTAACTGTTGAGATGAAATCTATATTTTCTTACTTTGTATGTTCCATGTATAGGTATGGATTACCATGGGTCAATCTTTTTTGAGATAAGATCCCTAACTGAACCTGGAGCTCACAAATCCAGGTAGACTAGCTGGCCAGTGAGCTTCAGGGCTCTTCTACCTCTGACTTTCCCAAGTACTGTGATAATAAACGTACAACCCCTAGCCCCCTTTAAAAATGAGTGTTAGGGATCTGAACTCAGAATTGCTCGCAAGCCAAGCACTTTATTGACTGACCCATCCCCCTAAACCATTTGAGACAGGGTCTCTTGCAGTCCATGCTGGGCTCATGAGATCAATATGGGACAATGACTCTGAGTTTGGGATCTTCCTTAAGCCTCTTCTCAAATCCTGGGATTATAGGACTATAAAACTCCAAATACTTTTATACCCTTGTGACTTAAATTTTTTTCTGACAATGTGTTTTAATCATATTTACCCCATATCTAGTCTTCATTTCCCCTCCTACTGAACCCTCCCTTCCCAATTAATCCCACTTCCATCCTGTATGAGTGTGTCCTATAGTATTTAAGGTTGCTTGTATACACATGGGCAACTTACCAGTGGCTACATAACTGAACAAAGTGACTCTCTAGCAACCCTGTTCACGTCTATCATTCATGCAGTAGGATGACTGGTACACCCACCCAGGCAATGCTAAAGTCAGCATCAGTGTCTTACAGGAGCTAGCATTTCAGCACTGTTCAAAGCGCATCTATAAAATGCCACCACTAGTCTGAGGAACGAGGGGACCAAGAGAACCAACTCAATGCACATCAACCTATTTTTGAGTATCTACTCATTTTGCACTCACAAGCCATGGATCCTGGAACTCACTGTAGACCAGGCTAGCCTTCAAATTTTGGGGCTCCTGCCTCACTCTTGGGTGATGGAATGACAGGCAAGTACCACTACGTATGACTCACTGAGTCATACTCCATTGTCTCAATGAAGTTGCCATGACAACATCAGACATTAAAATGTCTGTAAAGCCAACAGCTGGTCAAAGCAAGAACCTTGGGACTAACTAGCAGGTGAGATACCGAGCTGTATCTATCTATTCTAATCCCAGTTTCCAACCCATCATGTTAGATAACTTTTACTTTTACCCAGGGCTTTCAAAATTTGGTTAAAAATAATTTTTTTTCCTGCAACTGTAACCCAATGATAAAATTCCTTGCCTCACGAGGATGCATAGACATCATAGACTGCCTTATCTCTTCAAACTCCTCCAACTTGAGCTTCCAACTCTACATCTCACCTTTGAAGGCTCAAGTCACAGGGTCAGCATCTCATGTCCCATGGCAGTGACCTGCTAATGTTATTGGTACGTTAGCAAAGGCAAAGCAGCCTGCCTAGTCTAGAAACAGCTCACCTTTAACCCCACAGTATCAGGCTTTCGGGACAAATTTAAGTTTTCCACTGATAAGGATGCCCCCTTAATTAAAATTTAAAGCTAAGGAAAAAATGCTTAATTTACATTTATACAGGATTACAGATACTTTAAAAGTTCAAAACATTGAGTTTTATTGAAAATAATAAAGTACAGAAACACCAGATTCTCATCTTTAAAGCAAATCTGACACATCTTCCAGCACGTTGTAGCACTGCAGCATTCTTGTTGCTGTTAACAAAGGCGGCTCCAGGGCCAGAGTGGTTTGGCCTGCTGCCTAATAGTCTCCCTCGGCTCTAAGGCCTGCCTTGTTTCTAAATCTTAGTTTTACCTTTTTAAGAACGAGCAGTTTTTAAACTGGTTCTTGTCATGAGAACTGGATTCTCATATTATTAAGAACAACAACAACAAAAAGCCCCAAGCCAAGAACCAAAAAACCCACATACACCCGACTCAGACTCACTGAAAATACATTTGTTCATCAGAGCTCACCTGCTTTAGATAACTGTTGACTGTCACATTAGCATACTGAGCCAATGTTGGATTCACACTGTAAAAACTATACAAGATGAAAAGACCTGTTAATTCCTTAGGAAAACCTTAAGGCAGAAGCCAAAGTCTTATGCTAGAGAGGAGAACAGAAGGCAAAGGTATCAGAGCTGTGGAGACAACTGGGTGTGTGTAAGCACCACAAGGATGAAGGTGATTTCTGTACAAACATGTGCAAGAAGATAAAATCCAAAAAGGAGCACAAAACATCTACTTTCCTGTTGAAACAGGGTCATGTCAGGTAAGGACTCCTGACAAGTTAAGACATCTCTGCTCTCAAGTGGTTACCAACTGCATCAAAGCCACTCGGGCCTTTCACAGAGGCAGTCCTGGTGTTTTAGGCCCTTTGGAAAGCTGCCACTACCTTCCTACCCTAACACTGGGCTAACTCCAGACTCTCGGCATCCCTGCATGGTTCTAAACTGTTCTAAAACTTAGCACAGAGATTTCTTTAAGGCTATAAACTTCACAAGCTGGTCCCATTAGATAAGCCAGGAGTTTTCAAATGACACGAGCCAAACCCTTGCACATTCACAGAAGACAGCTTTCATTCCCCTAGGAGTCTGAGATGAAGAAACAAGTAGCTGGCTTCAAGACTGGTTTGAAGGTTGATTAACTTTATTGTGTAGATATAAATATTTTGTTTAAATATTAAACATTAAACCTTTTCCTGACATCTAGACAGAAACGGAGAGAGCAGGAACAACAGCAGAGGAGACAGTCCAAAGACAGACGGACTCCTATGCCATCTGCAGGAGGGAGGCCAGCATGGGTTGCAAAACGCCAAGAAGCTACGTTTCTAAAAAGTCACCCCCCCTCAGCATAAACCTCTTCTCTGTTCTCCCCTATACAAAGGGAGAAGCAAGCCAGAAACTGAAAACTCAACTGAGGAGGAGTTCAGCTGTAGAAAGAGCCGCCACACTCACTGGATGGATAGCTTACTGCTCTGCAGCGCTGAAGGACTTGCGAAAGCCCTCATTACACGTCCTGCCATGCTGAAGAGCTCTTCCTGAGAAATTAAAAACTTTAACCCTGGTTATTTCCAAAGAACACCTTGAGACTGGTTCGGGTACTAAAGGGTAAAGATTTCCTGCTGGCAGGAGGCCATCTTCTGCTAACTTTTAGGCTTACTGCACAAAAGCTTAAGCACCTGACAATTAGCTATTTCAGTAAATCTCCAAGACACTTCTCCATTTCTTTTCAGCTAATTCACTGTTTTTGGAACCAACATTAAAAAAATTCAACTTGCAAATACAAGCACAACTTTCCCTTTTTAAACTCTAGAAGCAATCAATTGTAGGTTTAGCTGACACAGCATGTCCTTAGGATTCATGAAAAGACATTTCTCTCACAGGCAATATACCTCCCAGTCTTTAAGTCAATCACTGAAGTTAACTGAGGTGTAAACATTCCTGACTAACTGAGCCTATCCGTCATGAAAGGAGATCAAGGGCTACTACTTGGGTGATCCAGCTACACCAACCTGACACCAACACAAGTTTCTTTGCTTGTTCCATTCCTTCACAAGAGACAAGTCCTGCTCTCTTCCCTCCCGAGCCCCACGTGTACAGTGACCACTACAAGTAGCTCAGCACATGACTCAGCAATTAGGGTGCAGTGGCGATTAGGAGCACTCCTGTACAGAATCATCTCAAGAATGAATGGCTTCAACAATGTGACATGACCTAAGTCATCGGAACACATCCAGCATCTATAGCTGTCGTTAAAGAGACTGTAACATTTCCTGGATAAGCCTATTAAAAAACTGCATTTCCCTTGAGATAAGCTTCCTTGGCAAAAAGTTGAATTCAATAAATGGCTACCCACAATGACAGTCCCACCCAAGTCACAGGCAGAGGAGATATTACACCCGTTTCATAAAACTTTCAGGCCCCTATACTCTGCAGGCAGGCTCATTTCTGAACGCAGGAGCCTTCTCCGACTTGTCAAGTTAGAGCAGAACGGGTGTCTAGAGCTCCATCTCCTCCTCTGTGCTAGTAGCTGCCTCCAGACTACGGTAAAGCGGCGCGTCTGCGCACTGAGGTTCCAGCAACCCTTCAGTCCTCTGTGGGAACGCAGTGCCCGGAGCTGCGTGCTTTGCTTGGCTCTCTCTCCTGTAGTTCTTAGGGCTAGATGATGGCTTTGGCTTCTCAGGAAGGAGTTCAGGGAGAGGTTTCCAGAGCACAAGCTCCATAGAAGGACGGCTCCTGGGATGTAAAATACAGATTTTTATCAAACTCTAGGAATGCAAATGAAGGCTACCTGTAACAAGCTGCTGTCTCTCAGTCAGTCTAGGCTGCCTGTAACAGGGTCCTGTTCACTCCCAACGCCTCAGTCAGTTAAGAGCTGGTGGTCCTGAAAGAGCTGGTCTGTTGTTGGTGTATCCCTATCCATTAACTACTACCAGTTTCAGAATTATTTTATCTTGATGTCTTTTATCAGTTCTCATTATAGAAATTTAAATCTTTTAATTAAAAGTGTGGCTGGGTCATGGTGTTTCATGCCTTCGGGAGGCAGAGGCAGATGGATCTCTGTGAGTTCAAGGCCAGCCTGGTCTACAGAGCGAGCTCCAGGACAGCCAGGGCTATACAAACAGTCTTGAAAAGCCAAAGAAAACCAAATGTGTTCACTTCAGCAGAAGATATACTAAACTTTGAATAATACTGATTAGCATTTGTTAGTTAACCAATGCTTCATTTTAAAAAAGAGCTAGAGATATTTAGAGTTCAAATGGACTTAGCAAAATAAAAAGCACATTTATGTGCATGTGTGTCTGAGTGTCCATGGGAATATGAACATGTGTTACAGTAGGGGCTGGTGTCTCTTCACAGCAACAGAAACCCTAACTAAAACCCTAAAAGAAGTGAGCATTGTTTCCAGGCCCTCAAATCTGTAGAAGTTCACATGCTGGAGACTGAGCCCAGGACTCACACATGAGCGAGTGCTCCACTTCCTAGCAACATCACTAGCTCTATATGTATTTTAAACCAAATCAACACCCAGCCTTACAGATGCCATAACTAGCAGTAATATAACTATCCAAGGTGAAAAGTAGGGCCTTTAAGCTGGGTGTGTTGGTGCACTGCTTTAACTCAGCACTCAGCAGGCAGAGACAGGTGGGCCTCTGTGAGTTCAAGGCTAGCCTGGTTTACATAGTGACTTCTAGGATAGATGGAGCTGCATAGACAGAACCTGTCACAAACAAAACCACCACCACCAACAACAACAGCAATGTTGTTGATCTAATGCTGTAACCTGAAGTAGGTATGTGGGGGTGGAACTCAGCTGAGGATCACTGAATCACATCACTAGCTATAATGATAGAATACACAGAGACGTTTTATGGAACATTCTTGCGTGACTACAGTCTTTTGTTTAGAATGTGGTACTGAGTCTAACGCACGCTAAGCAGCTATTCTAGTGCTACATTATCTCCCTACCCAATGGCTAGCTGATATATCACATTATTATCCATGAAAATGAAATCCTCGGCAAACATTAATTTTTGATAACTTTTGTTTCATACAGTTCTGAAGTAGAATGTTTCACAGTTAAAGCAAAACAATTACATGAAATATGTGAAATAAAAATGTTTTTCTCAACCATAGCTGTGAGCAGTACCTTTAATTCTAGCACTTGGAAGGTGCAGGCAGGAGGGTGATAAGTTCTAGGCTAGCCTAGGCTACATGAGCACCCATCTCCAAAGTGAGAAAAAAAAAATGTCCTTACCCTTGGTATAGGAAAAATCTTCTGGGACACAGAAGTAAATAAGAAGATAATGAAGAACACTCTCAAAGGCCCAGCTCTGGAAAACTACTGAGAGCAGTAGACACTATTTTGAGCAGAAGGGCAATGTGACCTGCATACACAGTGGCTACACTACTGACACACCCTCAGGGCTGAATAGTTAATTATAAACTCAAGCTAGGGCCTGAGTGAAAACCTGGACCTCCCACAGCAGTAGCTGCACTGCCCCCTCTCTGCCTAAAGGCAACAGTGGCCAGCACTCCTGAGGTCCGCGTCCCAAGAGCACTTTTCAGATCCTACGCTCGCCCTCAGTGATTAAGGCTACGGCTCCCAGGCAGTACTTAAGTGGACAGCACAGCACAGCACAGCACAGCAGTTGAGGACCAGCCAGTCCACACTAGATCTAAGCAGAGCACTTTCTAGGCTGCCACTTTGCTTGGCAGACTCTTGGGTTTGAGTTCTACTCTGAAAATACAGCAAACCAGTTAACTGAGCTTATTAAACCATGGTGTTTTTCCATCTTTCTTTCTGTGCTGCTGAGAGCAGACCCCAGGGCTGCACTGGCGCAGGCAAGTCCTCTACCCCGAGTCACTTCCCTAGCCCTTGCTTCTTGTTTCCATTCTTTGCTTAGTCTGGCTGGGCACCATCACATCCATCTTGAAAATATGTTGTGCTCTGACATCACCGTCATCAATTTCTCTTTCTTTTTTTGGGGGGTAGGGGGTGGAGATGGGGTGAATGATGACGTTCCATTCTGCAGCCCTGGTTGGCCTGGAATTCACTAGGTAGACCAAAACAGGCTGGAAACTAAGACCTCTGCCTCCGGAGTGCCGTGGGGTACCTGTGTGAGCCATGCCTGGCTTGAATTATGTTGTAAACCCAGTCAATGAAGCTCAAGGAGGAAACCTGTGCATAGGAACCTGGAGTACACAGAAACATTCCCAGCCCCCAAAACAAATCCAAGAGTTAAAACACTAAAATGACCACAGACGGCTGTGCTAGTTTGTGGGCTTCGTGATAGCAATGTCAACTGTCACTAATCTGACACATCACCTTCTGTTCCCTAGTCTCCATGCTGAGCCTGAGTGGCTGCTGCTGTCCCCCCCCAGCTTTAAGAGAACAGGCTTGGCAAGAGCCTTCCCAGGTGTCAGCACCAGCTGTGCACTTACATAGACTCAATCATCCTCTTTGTGAAGACTTCATCAAATTCCCTCTTCAAACCCGTTTTCATGGTGTCAGAAAGGACAAGACTTGGGAGGTGGCTAACATTTCTGTCACTTTCAACCTCTTCATCTTCGTCAATTATCCTAAATAATAAATTGGAGAAAGAAAAAAAAAAAATCACTCAAGGCACTGTGTGTTTCTTGTAGCAAATGAACAAACAAAATTTGAAACTAAAAGAAAAACCCACAGGTGCTGCAGCGAGAGATCATGTAAGCTACAACTCTGAGAAAAGTGGCCAAATGAGGCTGTTTTTCACCGAGAAAGGTTTGGAATAGAGTCAAGTTAGAAGAAGTGTCCAGGAAAACGGAGCTTGACACGGTCAGTAAAAGGCTTAGTCAAGCTCTATTCCATCTACCACTAAGTGTCTGTTGTTCATTCCCCATCTCCAGCACCAGGACGTGACCCCGAGCAGCCTAGGAGAGGAGAGCTGACACAGGACCACAGCACATGTGACGCGCAGTCAGTACCTGTCCTCAATCTCTTGCAGCCGCCTTCGGGCGACTTCACACTGTGGTTCTCCAGTTGTCTGATCCATTTCCTCACAGACCACATCTAGCATGCTGGGCATAGAAAGGCTGCTAGGACACGTGTTTACCCCATGACCTTCTCTTCCCTGATGTGCGCCGAGAGCCCATTCATCAGTAACTGCACCGAGTTCAGCTTCAGTCAGTCGTTTCTTTCTTACTGGACACCTAGGAGGAGGAAAGCAGCGGGAAGAGAGGGAAGGAAGAAAAGCAATCCATTATAGACGAAATGTAAGACATTTCTCTAACGAATTAAAAAAGATATATTTTTGGGACAAAGTCTCACTCTGTATCTATGTCTGGCCTCATTCAGAGTTCTGCCTGCTTCTGCCTAGAGTGCTGGGACTGAGGAGAGAGCTTACCAGGCCCAGCTAAAACTCATTTAGTTAAAAAACATCCATTTATTTTATGTTTAAGTTTCAGCCTGCATCATGTGTACTTTATGTGTGCCTGTGGAGGTCAGACGAGGTCTCAGACCCCCTGGAACTGGACTGACAGAGATATGAGCTGCCATGTAGGTGCTTGAAATGGAACCTGAGTGTTTTCTGCAAGAATAAGTGTTCTTGGGGCTGGAGAGATGGCTCAGCGGTTGAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTTGATTCCAGGCAACCACATGGTGGCTCCTGTTGGGAGCCGCCCCCACATTCGCCGTTACAAGATGGCGCTGACATCCTGTGTTCTAAGTGGTAAACAAATAATCTGCGCATGTGCCAAGGGTATTTTACGACTACTTGTACTCTGCCTTTCCCGTGAACGTCAGCTCGGCCATGGGCTGCAGCCAATCAGGGAGTGATGCGTCCTAGGCGAAATATAACGCTCCTAAAAAAGGGGACGGGGTTTTCCGCCACTCTCTCTCGCTGGCATCTCTCTGGCTCTGCGCGCCCTGCGCTCTCTCGCTGCCTAAAGATGTAAACAATAGAGCGCGCTCTGCGCTTTGGCGCGCCGGAGCTCTGGCTCCTAAAGATATAGAAGGGGCTTTCGCTTTTGGGGCTGGGGGTTTGCGCTCCTAGCTCCTGAAGATGTAAGCAATAAAGTTTTGCCGCAGAAGATTCTGGTCTGTTGTGTTCTTCCTGGCCGGGAACGCTATTAAGAGGCTCCCAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTATTCATATAAATAAATAAATCTTAAAAAAAATGTGCTCTTAACTAAGCTACCTCTCTAATCCCAATTTATTATTATTTTAATCAAATTATTAAATACAAACATTTCTATTTTTTCCTAGTTAGAAAATCATGCCTTTTCCCCTCCCCAGAAAATTTTCTTCTATTCCTTTTTTAAACAATTTATGCAGCACCTCTAAGATTTTAAACTTGTAAATTAAAAGGAAAAAAATCCATAGGAAAAATCAAATGGGACACAAAGCAATAGCAAGGATAAAGGAGGGTGGGAGAGGGGCTCGGCAGTGAGGAGCACTGCTCAGCAGTGAGGAGCACTGCTGCTCTTCCAGATTTCCAGCACCCAAATGGTAGTTTACAAAGTCGTGTAATTCTAGTTCCAGGGAATTCTATACTCTGTTCTGGCTATACACATGCATAAACACAAGCAACACCCATACACATTAAAAAAGAAAAGACAAAGAAGCAATTTCTCCCCAGTTACATTCCCTGCCTCCCCGTGGCCCCCCCCACCCCCCACCAGTGGCTGGCTATATAACTGTATTTCCCCACACCAAATACACATGATACTAAAATATGCTTCAAATACCACAAAAGCAGGTCATTAGCACAAATTTCTTGCCTTTGGCTATGTGTCCCTGAACAATAATGGGATCTACCTTTCTCTTAGTATAATACATTCCACCTGCATCTTAGATACGTTAGTACTTTTTAAAGAGACCTTAGAATTCATCAAACCCAGCTTCTTCCTTTTGGACCTATCTAGAAAGTAGAGGAAACTTGAAAGTTGAAGATTAGACCCCAGAGACCCTGATTCTCATCTCTATGCCTTTTCATTAAATCCCTTGCTTTTTCGAAAGGAAGTTAACTGTTTAAGCTCTTATATGAACGCGTATTTATTAGCACTATGATATGTCCATTGCAAGCTAAAAGCAGCACAAAGCAGTAAGACAGTTGGCTGCTGCCTTGTTTTTCCTTTTCTTTTTGACAAGTGTTCAGAGCACAGGTGTTCTCCTGCATGGCAGTTATCATGTGTAGCAACAGGACTAGACCACAGATGTATAGCCAAAAAGCTCACTCATTATTCCTACACTTCAGATTCACTAAACTGGAAGTCAAAGAAAACATAATTTCATTCGTGTCAGCACTGTGAAAATCAATAGTAAAGTCTCTGGATTATAAAATCTGACAATGCCTCTTAAACTTATATTTTCAAAAAATCAAAATCCACTCTTATGTTTGATTTAGAATTTTACCTCATTCTAGTACTAGAAATGTCTAAGAGACAGAAGCTGGAGGGTCAGAAGTTTAGGGTTGGTGTCTGCTAC
Comments:

htgt@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244