High Throughput Gene Targeting: Create Design

This custom vector design tool is provided by the EUCOMM consortium as a service to the research community. When using this tool, the user agrees not to submit more than five designs per day for creation without prior discussion with the High Throughput Gene Targeting Group at the Sanger Institute.

Design Type Oligo Select Method Artificial Intron Design
 
       
Gene Build Gene
Start Exon End Exon
Target Start Target End
Primer Length Design Comment
Created by erb
Valid After Annotation
not done
oligos on fwd strand oligos as ordered View gene and design in Ensembl UCSC BLAT recombineering primers
Design ID: 214229
Chr: 11
Strand: -1
Status: Ordered
BACs: RP24-419H4 : RP24-130N21 : RP24-130B17 : RP24-275A13 : RP24-333A11 : RP24-71N19 :
Instance: Plate 161: Well D08: BACs RP24-71N19 RP24-130N21 RP24-333A11 RP24-419H4
Oligos on GRCm38:
Type Start End Length Seq
G5 69671959 69672008 50 CTCTTTCCCACGTTATGTCGCGACCTCATCTTGCCTTTCAGTATCCGAGC
U5 69665942 69665991 50 AGTAAGAGATTGGTTGGCCACCCAGGTGCAGGCTCCTGCCCATGAGCCCT
D3 69664637 69664686 50 AAAGGGGAAATAAGGCAGTCTTGTAGAGGAGGCGGAGGTCTAGAAAAAGA
G3 69660423 69660472 50 GACCTGAGTGTATATAAGGGAATACCACAACAGAAATACATTTTAAACAT
Oligos:
Type Start End Length Seq
U5_D3 69478139 69479493 1355 AAAGGGGAAATAAGGCAGTCTTGTAGAGGAGGCGGAGGTCTAGAAAAAGAGTTCTGGGGAAGGTTTCCAGAGCAATGGGAGAGCTCTAGGAAAGAAGAAGTAGGTAGGGCTTACATGGCCCGAAGTGTCCCTTGTCAGGCAGCTGAGCAGCCTGTAGCCTTAGAGAGAGCAGGTCAAGGTGAACAGCTGGAGAAAGAACTATGCTTGCATTTCCACAGCAGAAGCTTTGGCCCAAGGGAGCTTGGAGCTCTCGAAGAGATGAATTCTGCGCCATGAATGTCCACTCTGCAGTAATTAGTAATTAAGAGTCAAATCCAGTCCTGACTCCTGAGTCCTCCCCACCAGCCCAGCACGCCCAGCCTAGACTTTTAGTGTGGTAAGGAGAAGAGATTACTCACGTGCTGCCTGTGGGAAGGACACATTGTATTCCACCGCCATGTAGTCCAGGTAGACTGTACTCGGGCTCTGATGTAGGTCCTTAAGGTGAACAGAAAGACTCAAGGCATCAGGGACAGAGGCATCCATGTCCACAGAGCAAGAACAGAGGCTCCGGGGGTACAGGTATGGGATATGGAAGAATAGAGGATAGAGACAAACTCAAGCTGTATACCTGTTTGAATCCAAAGGTAAGCTGTCCATAAGGAAATGAGAGAGACAGGTGGGGATGGGTACCGTCACAACCTCCCTGGACCTTGGTTTTGTTGGGATTCAAAACAGATATGCCCCAAGCCTGTAGAAGTGCAATGGTGGGTCTGAAATCACAAGAATGCTCCATCCAGTTTATCCCCTCCTCTTCTCTTCCTCTTCCCTGCTGAACGAGCCCAGGACTTGCCTCTTGCCCTCTTTAAGCCCCACTTTAGCTTTACCTTTCTTCCACCCTGAATTGGGTATAGGATTCGGATTTGAATTTGGGCTTGGAGCTGAACACAAGGCTGGGAGCCGTTGGCCCACGTGTAGTTCCCAAGAGCCCCCTTGGACCTTGGACTAGGCGAGGGTGGAGGTGGTCCAGGGTGAGGGCCAACAGTGGAGGATCTTGGACTAGTAGCAGTGCCATTTGTGGTGGGAGAAACTGTGGCATGAGAAATTGTGGCATTCCCATGACTGGTGGTGGTGGCAGGGTTATGAGTGACAGTTGTGGGTCCGGAGCTGGTGTGAACTGTGACATTTCCGTGACTGGTGGTGGTGGGCCTGTGGCTGGTCGTAGGGCTGGCTGTGCTTTCTGTGGCTGTAGGTGTCATCGTGAAGGATGGCAGGAGAGTAACGGCCTTTTTGTGAGGACAGTCTTCCTCTGTTCCTTGGGCTTTCAGTAAGAGATTGGTTGGCCACCCAGGTGCAGGCTCCTGCCCATGAGCCCT
15_E_15 69463139 69494493 31355 GTGTGCCACCACGCCCGGCAAGAGTTTTAATTTTATTTCCTTAGTGATAACAACAAAAATTAAAAGCCTAATTCCTTCTTTATCCATTTAGGCAAAGTGATCGGAAAGAACGGGAAAGTGATTCAGGAGATTGTGGATAAGTCTGGTGTGGTGAGGGTTCGTGTGGAAGGAGATAACGACAAGAAGAACCCCAGGGAGGAGGTACTGTTTTCTGGGGTCTGGTGACTTGTGGAGGGCAGAACACAGAACCTTTTGTTTGCCCTAGTATACTATGATCCTGTCAGTCTGAGAGGTGGGCTTAACATTTCAGTCTTTTTGTTTTGTTTTGTTTGAGACAGGGTTTCTCTGTGTAGCCCGGGCTGTCCTGGACCTCACTTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGCCACCACGCCTGGCAATCTTTTTCTTTTTTCTTTTCTTTTCTTTTTTTTGAACAGTAGCTCACTCTATAACCCTGACTTGCCTGGAACTTACTTTGTGAATCAGGCTAGCTTTAAACTCAATTCACAGAGATGTGCCTGCCTCTGCCCTTCTCAGTTTTGGGACTAAAAGTGTGTGCAGCGGTGCCTGGCTTTTTTTTGTGGGAATGGGGAGGGTGGCGGTTTCGAGGCAGAATCTCTGTGGCTTAGGTCATGCTAGCGCTTTGCTGAGAAGCTGAGGATGGCTTTGTGCTGTTCTTGCCTCTGTCTCCTTGGTGCTAAGATCATGTGTGCCATCACGCCTGACTTGTAATTTTCCTGTTGGTCTTTTCTCCAGGGAATGGTTCCCTTCATATTTGTTGGCACCCGAGAGAACATCAGCAATGCCCAGGCACTGCTTGAGTATCACCTCTCCTACCTGCAGGTACCCATATCAGAAGCCTGGGGCAGGGACAGGCGGGGTGGCAAGGAGGGCATGGACCTCTAGGACGTAATCTTTGGGACTATTGTGCCTGGTTTGTTTGTAGAACAGGACCATTGGTGGATATTTTGGCTCTGAGACTGTATCCCGAAATGTTCTTTTTAAGCCTTTGTCTTCCTAAGCCTAAGTCTTGAGAGCTCAGCAGCGTAGGACCATGTGACATGGGTGGGGACGCTTGGAGGAAGGGGACTGACTACTCTCTTAATTCTCCTGTGTTTCTTCCATCTTTCCAACCAGGAGGTTGAACAGCTTCGCCTGGAGAGACTGCAGATTGACGAACAGCTTCGGCAGATTGGGCTGGGCTTTCGCCCTCCTGGGAGTGGACGGGGTGGCAGTGGTGGTGGCAGTGACAAGGCGGGCTATACCACAGACGAAAGCTCCTCCTCTTCCCTGCACACGACCAGAACCTATGGGGGCAGCTATGGGGGCCGGGGCCGGGGCCGGAGGACTGGTGGTCCTGCCTATGGTGAGACAGCTGTGTGGGCAGTGGAGGAGGTGGGTGGAAACTTAGGAAAGCAGTGACTGACCTGGGTCCTGTGAGTGGTAGGAAGAGGAATTCTAATTTAGATGTGGTGGTTGAACTCCTAGGACAAGCACTATTGTCTCTGAATAAACCCTTCTGTGTTCTTTAGGCCCCAGCTCAGACCCCTCCACAGCTTCAGAGACAGAGTCAGAAAAGAGAGAGGAGTCTAATCGAGCAGGACCTGGTGACAGAGATCCCCCAAGCCGTGGAGAAGAAAGCAGGAGGCGGCCGATTGGGGGCCGGGGAAGGGGACCCCCACCTGTTCCCCGGCCTACCTCAAGATATAACTCATCATCTATTAGCTCAGGTATCAGAGCTGGGGTCATGGATGGTGACCTGAAGGAGAAGACAGTGGCCACCTGACTCCCCAGCCTCTTCCTTTTGTTTCACTAGTGCTAAAGGATCCAGACAGCAATCCTTACAGCCTCTTGGACACATCTGAACCAGAGCCTCCAGTTGATTCGGAGCCTGGTGAACCTCCTCCAGCAAGTGCCCGTCGTCGCCGTTCCCGCCGCCGCCGTACTGATGAAGACAGGACTGTCATGGACGGAGGCCTGGAGTCTGATGGTCCTAACATGACAGAGAATGGCCTGGGTGAGGGGCTAGCCTGGAGAATTCTTAGAGGTGTGATTAAGAATGAAGTATGGCCGGGCGTGGTGTTGCACGCCTTTATTCCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTTTGAGTTCGAGGCCAGCCTGGTCTACAGAGCAAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTGGAAAAACCAAAAAAAAAAAAAAAATGAAGTATGAGAGGGTGGGTGAATGACTCTTCTTTACTCCACAGAAGATGAATCAAGACCCCAGAGACGAAATCGCAGCCGCCGCCGCCGTAATCGTGGTAACCGGACTGATGGGTCCATCAGTGGAGACCGCCAACCAGGTCAGCTGACATACAGAATTGGAGCCTTTCTGGAACTAAGATGAAATGTCTCATTGGCTGGGAAACCAGGGTTGGATTCATTGGGAACCATGAAATCCCGAAGTTCCTGAAAGTCTTGATCCTGTGTCTTTCCTAGTGACTGTGGCTGACTATATCTCACGGGCAGAGTCTCAGAGCCGCCAGCGGCCCCTGGAACGCACGAAACCCTCAGAGGATTCTCTTTCAGGACAGAAGGTAGGCAATCAAGATACAGCCTACCCCACTTTGTTGTTGTTGTTTGTTTGTTTGTTTGGGGCAGGGACACAGAAAACTTTGCAAAGAAAGTTGAATTGACTGTATGTGATGGAGTTCAGGCTAAGCTGAGGGTAGAGCAGAGCCGGCACAAACAGAAGACAGGGCTGGTGGTGATTGAGCACAGGGGGGTGAGGGACCTGGCCTCCACGTGTGTCTGTAGTGAGAAGGAAGGCGTGCCTGCATCTGCTGTACTCATCAGCTGCTTCCTTTTTGTTTTCCTCCTGCTTCCTCTGTAGGGTGACTCTGTCAGCAAGCTTCCCAAGGGCCCCTCAGAGAATGGGGAGCTCTCTGCCCCCTTGGAGTTGGGTAGTTTGGTGAATGGAGTTTCATAAAACCTCCGGTCCACATCCCTCCTTTCTCCATCTCGCTTGCTGCCCACCACCATGGCCCTCATGGGTCCAACTGACCTGCGCTGGAGCTGCTCTTATCTACGGGGGAGGGGGGTGGCACAGCAGCTTGGGTCCCCCCCAACCTCCAGGAGCTAGTGGAGGGGTGTGTAACAGGGTCATACCCCTCCCTCTTGTCCACCCTACCCCCAGGGTGAGGGAGCCTCCCCTTCCCTTTCAGACTGGATGTGCCTTTATCCTCTAATGCCCCGACCTCTGAACACCCCCATTCTCCGCCTGTTGGTGGGGGTGCTCCTTGACCCACCCAGATTTGACAGTTCAGGGGGGCTCCCCTGCTATCCCTCCTCCCATCCTGTACCCCCCATTTCTGGGGCCTCATCACTGTGGAAGACGGGGATAGTGAGGGTATTCGTGGGTGGGAGGCATGGGGAAGGTTTTGGAATAGAACCAGGGGTATGTATGAAGGGGGGTGACAAGGTCTCCCAGGGGAGTTGGGAGGAAATAACCTTGTCTGGTGGATGAGAAGGCGTATTTATTTTTCACTGTACAGTATTTAAAAAGAGAATAAAAAAATCCAAATGGCCTTGTGTTTCCCATGTTGCCTTTGTCCCCAGTCTGGGCTGTTTAAATCTCTAGGGCTGACCGGCATTGGTCCCTGGCTCTCGTTCTATAGCCTTTATTATCAGCTCCTCGTTCTGTGTCAGGAAGATGATATTCTGGGAATGGCTGCATCCTTAATTCTCCGTGGCCAGAGGACCGTGCTTCAGACCTTGCTGTTTCTTCCCTCCCTTGGTTGTTGAGAGTTGGGCCACTCCTGAGCCCTGAGTCACAGGAGGATAGGCCAGGCTCCGTGAAGCTGGAGCTGTTCCTGGTAGAAGCTGAGAGTCTGAGCAGGCTGTTTAATCCGATTATCTGGGGCCTGGGGCACAGGCTGGGCCTTCAGCAGAGAGGAAAATAGGGTTTCCTCACCATAGCCTCTAGAACTCAGGAGGGCAGGTTGTATTTCTGGCCTGGTGTCACTCTAGCTCTAGAATCCATGTCACTGACCTCAGCTTTTAGGGGCCTCAAGGGTAAAGAGTAGTGACTATCGGAATTGGGAAGCGCCAGAGCTAGGTACAGTGCACTGCACTGTGGTGAACTGAACGTGATCCTCAGGAGGGTGTGCTGAATGCTTTCTCCCAGAAACCTTAGAATGGAGGAAATCGGGATTCTTAACTATGTAACTGCTGGGCAGTACTGGGCACACGCCTTTAATCCCAGAACTCTAGTCCGAGATAGAGGCAGGTGGATCGAGTGAGTTCAAGGGCAAGACAGGATTATTAGACTAAAGAAAGAAAGAAAAAAAAAATTCCGGTACCCAGGAGGCAGAGGTAGATGGATCTTGATCAAGTCCAGCCTAGTCTACACAAGGAGCAAGGAGTTCAGGCCAATCAGGGCTATATGCTGCACTCCCTGTCTCAAATAATTACACTTTAAAAAAAAAAGAAAAAAGGGATCAAAGGGGTAAAGAAACAGCTCAGCACTTAGGTAGATTTCTGAGTTCAAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACAAAAAAAAAAAAAAAACAAAAACCATAGCTCAGAAGGTTAGGTGCCCCCTGAGATCAGTCACGGAGATAGCCACTACCACCTCTCCACCTTGACCTGGGAAAGAGAACGGACTTGTGAAAGTTATCCTCTGACCTCTATATACAAAGTGGTGACACTTGTGCCCCACCCCATCCATAACCTTTTAAAAAATAGGAAGATTTTTAAAAAGTGTATCTGCAGGCCCAGAGGCATGTCCATGGTTTGGGCTTAAAGATGAAACTTGCAATACTCAGTGGCAATGGGGAACCTCAGGACTGGAAGTGGCTTTGAATGTTTTCATCTGCCTAGCACCTGCTGGAATGACTAAGAAAACAAAAATGGCCTTGAGTTTCTTTCCCCTGGGGCAGATCAGGGGTTTAAGGAGCAACAGACACCGGAAAAGGCTTTGATAGGGAGTGAGAGCTTCTTAAATTCTCCGGGTTTGATCGACCCTGGGAGCCTTTGGTTCCCCTTCTTGGGAAGGAAGTTACTTTAAATTGCTGGTGCTTGAGAATTGAGACAATTTTTAGGCCTGCCGTCCAGGCCTCCGGTGGAACGTTAGGGGGGTGTGGTGCCCTAGGGGGAGGTGTAAGGACTGGGAAGAACAAGACGCCTGGGTTTGCAGAAAGAAGAGGGGTGGAGAGAACCGCACAGCCACTGGGAGGGGTCTGGGGAGGAGTCAGCCTTTTAGAGGCTGAGTACAGGTGGGAAAGGCCTGTAGCACCTGGGTGCACTCCTGGCAGCTGTTGGGACTTTGTGGAGACCAAGAGCTGCACGCTTGAAACTGCAGTTTCAACAGAAGAACCCTGTCTCGCTGAAGCAGAGGGTAGAAAGAGCGACTGGTAGACCTGAGAGAACACTACCTCTCCGGTAAAGGGCTCCAGACAAGGATTCTAAATTCAGCTTCCCAGAGGTGACAATCGATCGCTGGGAGCAAAGTTTGGATTCAAGCGCTCTGGAAGATACTTAAGTACCCAAATATTCCTAGTCCAGTCTTCGCTCTGGGAGAAGGGCATTCAAGACGCCCTCTCAAAGAGGCTTCACCTCCAACCCATGGCGCTGACCAGCTCCTCACAAGCAGAGACTTGGAGCCTGCATCCTCGGGCTTCCACGGCCTCTTTGCCTTTAGGACCCCAGGAGCAGGAGGCCGGCGGGAGCCCTGGAGCGTCTGGGGGACTTCCGCTGGAGAAGGTGAAGCGGCCCATGAACGCCTTCATGGTGTGGAGCTCTGTTCAGCGCCGCCAGATGGCGCAGCAGAACCCCAAGATGCACAACTCTGAGATCTCCAAGCGCTTGGGCGCTCAGTGGAAGCTGCTGGGCGATGAAGAGAAGCGACCCTTCGTGGAGGAGGCTAAGCGTCTTCGTGCCCGCCACCTCCGCGACTATCCCGACTACAAGTACCGACCCCGGCGTAAGAGCAAAAACTCGAGCACCGGGTCTGTCCCCTTTAGCCAAGAAGGAGGTGGCCTGGCATGTGGTGGCTCACACTGGGGGCCAGGGTACACAACTACCCAAGGGAGCAGAGGCTTTGGGTACCAGCCCCCCAACTATTCGACAGCCTACCTGCCTGGCAGTTACACGTGAGTGCCTAATTGTGTCCATCTGTCTGTTCCATGCTTCCCACACGACCCCCTTCCTTGAGAGCTGGGTGGGAACAGAGGCCAGAGTGCCAAGTTAAACCCAAATCCACCCAAGCAGAAGCTACACCAGGCTGAGGGCCCAGAGTTCAGGATAGTGGCTGTTCCATCTCAACTAATGTGTCCTACCTCTGCCTTTTGGATGGCAGTTTCTCCTTGTGGCTGGCCCTTGTGTGACCCATCTTCCTCTCCCAGCCCTGGGGGCAAGGAGAGACCAAGCCCATCCTGTTGCTCCTTCCTGGCCTGCTGCCCCAGGAGGCAAACAGCCGTGCAGCACGCAAGCCGCCTGCTGAGCATGCCCCAACAGAACTACCTTGTTCTTTAAGTCACCCTAGGGTCCCATTCCATGCCTGCTGTACCCAGCAAGGCTGGCTGAATGGCAAGCTCTAACCCTGTCTGCTGCAAACTGGTCAGACCAGTCCCCCACGAAGAGTTGAGGACACTGCCCAATCGATTCAAGAAGACTAACCTCCAGACCCCATGTTTCTTTTTACAGCTCTTCCCACTGCAGACCGGAGGCCCCCTTACCATGCACCTTCCCTCAGAGTGATCCCAGGCTCCAGGGGGAGCTAAGACCCTCTTTCTCCCCTTACCTATCCCCAGACTCTTCCACTCCATATAATACTTCCCTTGCTGGAGCCCCCATGCCAGTAACCCACCTTTAACTGGCAGGGACGCCCAGGGCCAACCCCACAGACCCCTACAGATCTCCAAGGAACCAGAATGCACACTAAACACAATTTTGTACAATTAAAACCATGTTTCGGAGTCTTTTATTGTCCCATTTGTATTCTCTCCCTACAGCAGCAACCAGCGCCTTCACACACCCTTCCGCCAGGACCTGCCTCGGCAGGAACCTCCCCACCCAACCCCAGGGCCCTTATCTGAGTCACTCTCCCTCACCCCCAGAACTGGGCTCCAATAGACCATCCCACCCGGGCAGCACAGGGAAGCAGCCACTAGCTTCCAACCACAGTTTTCTAGGCTCTGTCCTTGGTCCAAAAGGAAGGTAAGTGGACAGGGCCAGAGCATCTGCTCCAGTAAACCAGCTGCTCACAAGGAGGGATCTGGGGAAGTGAGTGAGTGAAGGCAGGGCCTACACAAGCTTTACTGCTCCCACAACCCTGGCTCAGGAGGCTGCAGTTAGAGGAATGGAGGGTGCTTACACTGCACCCGCAGATCAAGTCATGTGGGGAGGACTCTGAGGATGAGTGGAAATGGAATTGTTCTAGAAGCGAGCTCAGCTCTATTGCTCCTTTTTCTGTTTGTGGGGAGCCTTTGCGTTCCAGTAGAAGAGGACCTGGGCAGCAATGAGGCCATTGCAGAGAGAAGAGACCACAAAGACTCCAGCCATGAGGGGGTCTCCAGTTTCCTGTTATGAGAGAGCACAGATCTAGAAAAGTTCCAAGACTCAGCAGAGAATGAGGTTTTAGTGCCCTCTAGTGGGCAGAAGGTGCACTCACCTGAACAGAAGTGAAGATTCGGGCCAAGGAGCCCCCAAACAGCATAAACACTGTAATGGCTGAAAGCTGGCCTGTGTGTCCGTTGCGGTAGTTAGTGGCTGCCTGAAGCAACTAGAGGAGACATTGATACTTTTGGTTCTCTCATCTGACCCTTCTCCGTGACCCGTCACTATTCCTCACGCCCTGCACACTAGCACTCCATAGTTGGAGGTCCTCCTCTGCCTTACACTAGCTCGCGCGCGTACACACACACACACACACACACTCTCACGTCCCTTTGCTTCCTACTTCCCCAGAGTACCCACCTTCCCCACCACCACGGCAGGTACATTGGAGGCCTGGAGCAGAGTGACTACAGCCAGAGGCGTGAGCGGGGAGAGCAGCGCCAGCAGGACCATGGCATAGCAGGCAAGGAAAGCGACTCCTGGGGGTCAGGGAGACAAGGAGTCCTCTTGAGCCTGAGTCCCCACCAAAGTTCCCATACACAATGCCTGCTCTCCAGCCAGTCCCCGGCACCTTTCACGGTCTCTCCTCTGTAGTGCATGACCAGGAAGCAGATGGCAACGGTCTGGAGTGTCAGGAACAGCGCTTCACCCCAAGAGCTGCAGAGTCAAGGGGTGGGAGGAAAAAGGCAGGCCTGGAAAAAGGCAGGGGAAGCCTCCATGCCCCGTCCGGCTCAGCTCTGGGATGAGCCTGTGCTTTTCAGTCTGCCACTCCCACCATGCCTGGCTCACGCAGGGAAGGCTCGCTCCATCCCCATATTTACTTATTAGAACTGCAGGTGCTGGGGCCAGAATAGCTCAGCAAGTAAGGATGTTTGCCTCTGAGTCTGATTGCCTACGTTCCAGCCCCAGGATCCACACACTGCAAGGAGAGAACCAACTCCTACAAGTTGTTCCGTGACCCCTCCCACCTCAAATAAACAAACTGAAAAGAAAAGAATTGTGGGGCTGGGCGGTGGTGGCACATGCCTTTAATCCCAGCAGTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACGGCCAGGGCCACACAGAGAAACCCTGTCTTGAAAAACCCAAAGAGAATCTTGGGGATTTGGCTTTGGGCGTGAAGAGTGGACCCTCACTCACCTGAAGGGGAAGTTGTTGGTGATGCTGTAGACCACGGTTCCGGTCAGTGCCACTAGCTCCAGCATTACTGACTGGAGACTCAGTCCTTCTGCACTCTTGGCTCCCAAGAGTTTAAATACCTGGGGCAGCTTGACTGTGGACAAAGCAGCAGGGCTGAGGAAAGGGCACTCTATCCCCAGCCTTGGCATCCTCAGCCTCTCACCTCCCTTCCCTTTACTCCAACAGCAGGAAGGAGCTGTACGTACCGAGAAGTGACCCAGCCACGATGCCCAGCCCGAGGCCTTTGCTGAGGAGAATCTTGAGGCAGGGAACTGAGAAGAGAGAGCAGTCAGCAGAGAGGCCTCTGGCGCCCAGGTGAGGGTTTGAAGTGCTCCTAGGAGCTGTTGCCCTCTCCCTCACCCGTGACCACCACACCTACCACACCAGTAAGTCTCTGGGGGTGGTAGGGATGACAGGGCAAACATCCTTGCTACAGACATCTTCTATTCAGACTGGGTGTGCTGTCACAACAGCTTCTTCCTTCCTGTCCCCCTTCCATTCCCTATAAATACACGTCTAAAATAGTTTTGAGGGCTGCAAAGAGTAGGGTTGTCCCCTTCAGAAGGACCAGGATAACCAGAAGGTTCTGAAATGTATGGTGTGGGCACTTGTCTTTGGAAGGAGGAGCATTTGAAGTAGGCCATCCAGTTCCTGAGGAGAGTAGGGTCAGGGAATTCTTAAGCAATGCCTGTGTAACTAAAAAGCTAACTTTTATCCCTCATTAACCCAGGAGCCACGTGGTAGACGGACAGAAACAACTCCAGAACTTCCATGCATGGCCCCCCTAATAAACTGTACTAACAAAAATGCACTAAGGCCGGGCGTGGTGACGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCTCTGAGTTCTCGAGGTCAGCCTGGTTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAACCCTGTCAAAAAAAAAAAAAAAGCACTAAGAAAGTATGTCTTTTAAAAATGGAGAGATGGCTCAGAGGTTAAGAGCACCAACTGCTCTTCCAAAGGTCATGAGTTCAAATCCTAGCAACCACATGATGGCTCACAACCATCTTTAATGAGATCTGATGTCCTCTTCTGGGATGTCTGAAGACTGCTACAATGTATTTACACATAATAAATTAATTAAAAATGAAATCTTTTTTTGTTTTTGTTTCTGTTTTTTTTTTTTGTTTTTCGAGACAGGGTTTCTCTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGCCACCACGCCTGGCTGAAAAAAAATTTAAAAAGTCATAAGGGATGTGTGTTGTAGTTCAGGCTTTTAGTCTTATTTAATCATCTCTGAGTTCAAAGCCAGCCAGAATTACACAGTGAGACCCTATCTCAAATACTTAAAAACTATTGTCAGGTGTGGTGGCAAAAACATTTAATCTTAGCACTTGGGATCGAAGGACAGCTATGTGAGTTCAAAGCCAGCCTGGTCTACATAGTGAGTTCAGGCCAGCCAGGGTGATATAGAGAAACTATTAAAAAGGCTGGAGATATGGCTCAGTGTTTACGAGTACTGACTGTTCTTCCAGAGGACCTGGGTTTAATTCCTGACACCCACATGGAGTTCACAACTCTTAACTCTATTTCGAGGAGATCTGACACCCTCATTCATACATACATTCAGGCAAAACACCAGTGTACATAAAACAAAAATAAATCTTTAAAGAAATCATTAGGCCAACAAGATGGCTCTGCTGCCAACTCTGTTGACCTGAGTGTATATAAGGGAATACCACAACAGAAATACATTTTAAACATTTGGGACTGGAAAGATGACTTAGTGGTTAAGAGCACATCTCTGCTCTTGCAGAGAAGATCTGAATTCAATTTTTAGCATCCTTCTCCAGTGACTCACAAATGCCCGTAGCTCCAGCTCCAGTGGCATCTTCAGGCCCTTGCAGTCATGTATAGTATACATATACACACACATATACAAGTGAAAAGACACACATAAAAAAAAAAAATCTACATTTCAAAACAACCCTGGCTGGCGAGATGGCTTAGTGGGTAAGAGAGCTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCCATAATGAGATCTGACGCCCTCTTTTGGTGTGTCTGAAGTCAGCTACGGTGTACTTATGTATAATAATAAATAAATATTAAAAAATAAATAAAAAATAAAACAACCCTATTTTGTGTGTGAGCACATAGGTGCATGTGTTCAGGTCAGAGACTTTGAGGAGCCAGTTCTCCCTTTTTGCCTTTCTGTGGGTTCCGGGAATTGTACCCAGGTTGCCAGCCTTGCAAGCCACCCCTCCAGTCCCACAGGCGTTCCCTGACTCTTTTCTCTCCCCCCCCACCCCATTCCCACATTCATACATTCCTGAACCTTCAGGTTGTCCCCACTCTTCCAGGACATTTATCCTTGTTCTTCCACTATCTCTATCATTTACTTCTTTTTTTTAAAGATTTATTTATTTATTTACTTTATGTGTGTGAGTACATTGTAGCTATCTATCTTCAGACACACCAGAAGAGGGCATTGGATCCCATTACAGATGGTTGTAGGCCACCATGTGGTTGCTGGGAATTAAACTCAGAACCTCTGGGAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCTATCATTTACTTCTTATCTTGGTTTTTCCAGACAAGGCTGCTCTGTGTAGCCAGCCCTGGTTGTATTGGAACTCATCCAGTTGCCTAGGCTGTCCTTGAACTCCCGCCTCTGGGTCCCTCCCAAGGGCTGGGATTAAAGGTGTGGGCCACAGTTCCTGGCAATTTCTCTAATTTTTTTTAAAAAACATTTTTCTTTCAAACCCTGTGTCCAGGGCTGATTTTCAATAGATTGCAGCGAGTGAGCTGAGCTGCTGCCTACAAAACCCTGATCCTGGCAATCTCTCTACCACTGAATCTTTGACCTGGTGGGCATTTGGCCCAGGAAGGCGTCTTGACTATTGTAAGCCAAAAGTCACTTAGAATAGAGAGATGGAGAAGGCTTATCAAAGGCCTTTGTAAAGAAAAAGGAAAGGAAAAGTGCTATACTCCCAACACTCTAGTGACTGAGGCAGGAGGACTGTTGCCAGTTCAAGGGCAGTCTGTGCCACATAGTAAATTCCAGAAGCTGGTGCTGGAGAGAGGGGATAAAAAAAAAAATTTGTGAGCCTCTGTCAGTTGAGTGCTTGGGGCGAAAGGAGGCCTACATGCCTGGCTGGGGTTTTAATTTTGTTTTATAAAATACGAGTTTTCCGCCGAGGATTGGTGGCACACACCTTTAATCCCAGCATTTGGGAGACAGAGTCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGCGAGTTCCAGGTCAGCCAGAGCTATACCCTGTCGGGGGGGGGGGGGGGGGTACGACAAAAAAGCTCCGAGTTTTCCAGCCTGGGGCTAGAGCCTGGTTAGCAGAGTAGCACATGCCGCCCTGAGTTCGACTCCCAGCCCAGAAAGGGATGAGGGTTGGGTACAGACTTCCGAGATTGTAAAACACAAATTTAACTTTTTTTCGGGAGACACCCCTTCATGCCCAAATATGGCACTTTTCCTATGCAGGGCCCCAAACACTTCCGCCCTCGTCAGAACCGCCTTCTGCCCAGCTTCGCGGTGACATTAATCGCCACTGTCACGCCAACTTACGGTTCAAGGCTGCTCCAGCTAGACCTTGAAGGCTGAAATAAAACTCACCATGAAGCAAGTCCCATTGCACGAAGAGCTGGTCGTAACATTTCTCAGGTAAAAGAATTGGCACCAGCAGCCCTTTGAACGGCCCGTCGGCCTCCCCCGCCATGTTGGAAAGCTAAGCTTCCGCCAGGCGGGACAACCCCCGCCATTTATCCGCGCCGCGCATGCGCGCCGCGCACACCCCGCCCTGCTGTCCCCGAGGCCAGGGCTGCTCTTCCCTCTCCGTGATGCTCGCCCGCCTCCTCTAGGGGACACAGGTCTCCTTCCCAGGCAGGCTTTTGTGCGCGCCTTGACGTTCGAATTTTAAAGCGTGTCCGCGTTTGGCGCCTGCGCTGTTAGGACTTCCTCACTTTTGTTTACGCTCTTGTTCTGAAAGCAAGGTCCATGCTGCCCCCTCGCCCTGTCCCCCCTGCATGTACGCCATCTTGTCTAATCTCGGCCAACTTGATAGTGTTTGAAGTTGAAAGGGAAAAGAGTTCGAGTCTTCAAAATGGCGCTAGCAGAAGCACTGCAGCTCTCTTTATCTTTCCTCTTGGTTTCTCCAGAGGGAATAGAGCCGCAAAAGAGCCATTCCGAGCTGGGCCTTCTTTCTGGTCCCCTGCTTCGTCCTCTGTCCAGATGTTAAGAGGATGACGGTGGGGCTGGTGAGATGGCTCAGCGGTTAAGAGCGCCGATTGCTCTTCCAAAGGTACTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAGCCATCCGTAAGGGGCGAGCTCCGCTGCAGGAGAGCAACCCCTGACACAACAGGGGACCTCAGTCTGCTGTGTCTAGGTGGGAACCCAGAGGGTGCGAGCAAAATTCCAGTATTTGTCTGGGAAAGGGCCCCTAGGGTTAGGCGAAGAGAGCCATCTACATTCCACCACACTGCCAGGACACCTACTCTTGGTTCAGGCTGTAGGGCATTCCTAAACTGTTTCTCAGTTCCTTGTTTTTGGGGGTGAGGGGAATGTAGTTGCTGGTCAGGGCATAATGTCACATGTACCTCTGCTGTGTGGGGGCTCTGGTCCAAGAATTTCTGTAACCTCATGGGACTGTTAAATTGGAAAGGCACCCATCCTTGGCTCCCATCCGTTGAACCATGTCCTACTATAAACAGTAGAATTTATACTTTGGTACAGTGGGTGGCTGTCTGAAAAATCCCTTTTTATATCTGGACAAGGGCAGATTGCAATTGCCACCGCTCCCTCTCCTTCTGGTACTCGGGGATGTGTTTGCGAGGCCTGAAGTTGTTCCTCGTAGCACAGCCTCATAGAAGTCGGCTGCACCAGTGGGCTCCTCAGTGAACTAGCCCCGGCCACAGTGCACATGGAATCTCATTGTTCAGTCACCACTTTTGAAATAAATTAATACAGCCACCTACTCATATTTTAGTTGTGTTGTACCTAGCTGCGCCCCGAGGGTCAGCAACAGGGTGTCAGGTCGGAATGATTCATTCTGTAAGGGACTAGGCAGCCATTGGCCCCAGAGGGAGGAGGGAATTTTGGCAGCTTCACCAGCAGTCACAGGACATTGAGGGATGAACCAATGAAGGCATTTGGTCACTCTCTGGTACTTTTGTCCCTTCTTGCCAGCTGTCTCTTGGTGACTCAGCCACGGGAAGGCACAGGAAGGCATATGACAAGAAACTCGTGGCTTTTAGCCCCGGCAGGACAAGGCAAGCCAAGAGAAAAGATTTCATTAAGTGTTTGTACTCTTAATGAGGAAAGAAAGGAGTAGTAGGTACCATTCATGTTTATTGATTCCCCACCCCTATTATAAAATCTCTTCATTGTGTTCCTAAAGACAGAGAAGGAAGGTAACTGTTGAGTCAGTGGCATGGTGAAGAGATGAGGCGCTCCTTGGTGGCTTACACAGTGGACTGGGGCAGATGCTCAGAGGGGCTGGTAGGTTGATTGTCGTCTGCGGGTGATGCAGAAGGCGATGAGCACCAGGGTGAGGAGGCCGAGGAGGACCAGGCCAATGATGAGAGGCAGCAAGAGGGACTGGTCACGGTTGCAAGAGAAACCTGGCAGAATAATGGGATCCCTGAGAATTGCTGCAGTGGTGGACGGGCTAAAGGTGGGAGGTGGGGGAGGACGGAAGAGGAAAGGGGATGAAGAAAGGCTGAGGAGCCAACCCATAGGTGAGAGCAGTCAGCAAAGGGGAAATAAGGCAGTCTTGTAGAGGAGGCGGAGGTCTAGAAAAAGAGTTCTGGGGAAGGTTTCCAGAGCAATGGGAGAGCTCTAGGAAAGAAGAAGTAGGTAGGGCTTACATGGCCCGAAGTGTCCCTTGTCAGGCAGCTGAGCAGCCTGTAGCCTTAGAGAGAGCAGGTCAAGGTGAACAGCTGGAGAAAGAACTATGCTTGCATTTCCACAGCAGAAGCTTTGGCCCAAGGGAGCTTGGAGCTCTCGAAGAGATGAATTCTGCGCCATGAATGTCCACTCTGCAGTAATTAGTAATTAAGAGTCAAATCCAGTCCTGACTCCTGAGTCCTCCCCACCAGCCCAGCACGCCCAGCCTAGACTTTTAGTGTGGTAAGGAGAAGAGATTACTCACGTGCTGCCTGTGGGAAGGACACATTGTATTCCACCGCCATGTAGTCCAGGTAGACTGTACTCGGGCTCTGATGTAGGTCCTTAAGGTGAACAGAAAGACTCAAGGCATCAGGGACAGAGGCATCCATGTCCACAGAGCAAGAACAGAGGCTCCGGGGGTACAGGTATGGGATATGGAAGAATAGAGGATAGAGACAAACTCAAGCTGTATACCTGTTTGAATCCAAAGGTAAGCTGTCCATAAGGAAATGAGAGAGACAGGTGGGGATGGGTACCGTCACAACCTCCCTGGACCTTGGTTTTGTTGGGATTCAAAACAGATATGCCCCAAGCCTGTAGAAGTGCAATGGTGGGTCTGAAATCACAAGAATGCTCCATCCAGTTTATCCCCTCCTCTTCTCTTCCTCTTCCCTGCTGAACGAGCCCAGGACTTGCCTCTTGCCCTCTTTAAGCCCCACTTTAGCTTTACCTTTCTTCCACCCTGAATTGGGTATAGGATTCGGATTTGAATTTGGGCTTGGAGCTGAACACAAGGCTGGGAGCCGTTGGCCCACGTGTAGTTCCCAAGAGCCCCCTTGGACCTTGGACTAGGCGAGGGTGGAGGTGGTCCAGGGTGAGGGCCAACAGTGGAGGATCTTGGACTAGTAGCAGTGCCATTTGTGGTGGGAGAAACTGTGGCATGAGAAATTGTGGCATTCCCATGACTGGTGGTGGTGGCAGGGTTATGAGTGACAGTTGTGGGTCCGGAGCTGGTGTGAACTGTGACATTTCCGTGACTGGTGGTGGTGGGCCTGTGGCTGGTCGTAGGGCTGGCTGTGCTTTCTGTGGCTGTAGGTGTCATCGTGAAGGATGGCAGGAGAGTAACGGCCTTTTTGTGAGGACAGTCTTCCTCTGTTCCTTGGGCTTTCAGTAAGAGATTGGTTGGCCACCCAGGTGCAGGCTCCTGCCCATGAGCCCTCCCTCCCCCACCTCCCATTTCTCCTTACCTATAAGCGGTCCTAGCAAGATCAGACACACAGGGAGCCGCATGGCAGAGATGCTCAGACCAGCTAGGCTACACCAGTTCCTTCCTCAATCCAATCCCCTTTGCCTTCTCTTGGAAGAGGAAATGAAAAGCCTCACTTCCCTTAACTAAAATAATCCCACCCCAAACCTGACTCAGACACCTCAGCTTTAGCAACCCACTCAAGCCATTGGTTTTCACAATTAGGCTGTGATTGGCAGTGACGTTCTCAGTGGGCGGTACAAAGCCTTGGTTACCTCGTGAGAATGAGGCAGCTGACTCACACGGAACTTACCTAAGCAAAACTTGCTCTACTTGGGAGCTTACAATGCAGCAGAGAAATGGGAAGCCCTTTCCTCATTGGTAAGAAATGCAACCCCACCCATGCACTCCAATCCTAGCACAGGAGGCCGAAGGCAGATGTAAGAGGTCAGCTTAGCCTATTTATTTAGTTGCAGGACAGGAAGAGCTACAGAACAACCATCTCCCTACATCCCCAAGGTGAGTTGACACCTACATCATCTGGGCTAGGCCTAACCAACCAGTTGAATTTTTTTTTTTTGGTTTTTCAAGACAGGTATTTTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTTGTAGACCAGGCTAGCCTCGAACTCAGAAATCCACCTGCTTCTGCCTCCGGCAGAATGCTGGGATTAAAGGCTTGCGCCACCATACCCAGCCAGTTTAAGTCTTAATGCAGCAAGTTTCACTCATGTCTTGTGCCTAACACTGAGGCAAATTACCAAATGTTAGTAATGTGGGTCATTTGGTATTGCAGGAAGCAACATGGCAAATTCAGTAATCAACTAGTATGGGGGCAGGTGATCCACACTAGCAGGTAGGAGGGAAGGGAAAGAAACAAGAAGCCCAAACAGGCAGTTTCCAAGTAATTTTATTCAGAATTTTGTGTTTGTTTCCTGAATCAATAAATACTATACAAAACAATGTAAAAATGGCTACCATTTTCTCTCCCCTGCTCCCCTCACCAGGGGACAATTCCCTGGACAACCTCACTCAGGGGTTCTCCCTGTAGATTTGGTCCAGCAAATGAGGCCAGCCTTGTTTTTTAGCCCCTTGACTCACTTTTGGAGATTTGGCTGGGGTAGGAAAGCCTTTAGGAACGAGGTGACTAGGTTAGGGAAATGCATTAGTGTTTGGGGGGGGAAGGAGACGGCGCCTGGGGCAGAGCCTACCCCAAAGAAAAGGGTGTCTAAAATGTTCACGGTTCCTTCTTTTTGCCTCAAAAAGTGACATTTATTCATAGAGAAAAAAAACTGAAACAAAAAAAAAAAAAGCCAAAACAAAAACAAGATGTCCATCCCTTGGCTCCCTCCCCTCCCCCCTCCAGCTCTTCCTTAGCCCCACCCCAGGACTGAACCCTGGGCTAGGGCCAGGTCGCAGGACAGCCCCTCAAATGAGGTCAGCAACGTTGAGGGGCATCTCTTCAATGGAGGTGTTGTAGAAAGTCTCAATGTCTCGAAGAGTCCTCTTGTCTTCTTCGGTCACCATGTTAATAGCCACACCCTTACGACCAAACCGACCACCTCGACCGATTCTGAGGGGGGTAAAAAGGATGATGGAACACTTGGGTTTCAGCATAGGGGTTGTTTAGTCTGTCAGACCTAGACTTACCTGTGGATGTAGTTTTCCCTGTTGGTGGGAAGGTCATAGTTGATGACTAAGGAGACCTGCTGCACATCAATGCCTCTGGCCTAGGTCAGGAAAGAATATAGCCATCAGAGGATACAATCTATCCTAATTAAGTAGGCATACATGTAGGCAGCCAGAGGAGGGCAAAGGAAACAAGAGTTTCTTGTCCACCAGAGACCTCAGGCACGCCTGGTTTTCTTCCAAGTTGCTACGTTCCTGAAAAGGGCACACAGTCAGCCCTTTGGAGAGGGAATCACCTTGGACTAACTTAACTTGTCTTCCTTTCTTTCCCTGAAAGCATCTACTCACCAACAGGTCAGTGGTAATTAATACTCTGCTAGAGCCAGACCGGAACTCCCTCATGATCACATCTCGTTCCTTTTGGTCCATATCTCCGTGCTGGAAAACAAAGAGGTAGAAGCATTTGGCACAAGGCTCCCAACACAGACAGACACACAGAGACACATAGCCATTAAAACTCACCATGGCAGAAACAGTGAAATCTCGGGCATGCATCTTCTCGGTGAGCCAGTCCACCTTCCTTCTGGTGTTGATAAAGATGACTGCCTGGGTGATGGTCAGCGTCTCATACAAGTCACACAATGTGTCAAGCTTCCACTCCTGGAGATTCAGAAGTCAGGGGTTACACTCAACAACTTACTACCAGGTCTGCCTCCTGCACTGGGCCTCACCTCTCGTTCCACATTGATGTAGAATTGGCGGATACCCTCCAGGGTCAATTCTTCCTTCTTGACAAGAATCCGAATAGGGTCTCTCATAAATTTCTTGGTCACCTCAAGGACATCAGAAGGCATTGTAGCAGACAACAAAACTACCTAATGGGGAAAACAGCAGCCATGATGAGGGCACTGTACATTCCTCAGATCACAACCAAGCCCCTTGTGTCCTATCAACCTCGCCATTTGTCCACCTGTGTGTTGCTGTTGAGCTTCTGGAATATGTCATAGATCTGATCCTTGAACCCTCGGCTTAACATTTCATCTGCTTCATCCAGTACGAACATCTTGATGTATTTGGGGGCTAGAAGGCAGAAGAAAAAACACCAACACATAGTGATCAGACAAATGTGAAATACATGGAAATCTCTTGGTAAGAGGGCAGTCAAAGGGCAGATGTCTGCTCTCAGAATACAAGGACTGATCCTTTGCCCAAAGCTTCCCTGATAAGCCAGGCAAAAGCCCTGGTAAGTAGAACACTACCTGGGCTAAGGTAACAACAGGGAAGCCAGGCTCAGATGACACGCATGGGGTTCATCACAGAGCAACTCAGTTCTAAACTAAAGGAAAACTTGCATCCAAGAAAATGACATGTGGGAATGCCCACCAACTGTTACATGGTACTCACACAGGTATCTCCGGTTAAGCATGTCAAACACCCGGCCAGGGGTACCCACGATGATATGGGGAGCTTCCATCTGCAGCTTCTGCACCTCAGCACGCACATTGGTGCCCCCAATGCAGGCATGACAAGAGGCACCCATGTAGTCTCCTAATGCCATAACCACCTTTTGTATCTGAATGCAGAAGAACATCTACATTAACTCGGGCGGTACCCACGTAATTCTCTCTCAATCCCAGCACTACAACCACAAATGGCAGTGCTGAATCCCACCACACAGGTTCACAGTAATTTCCCCACCCCTACATGCAGCCTTGTAAAAAAACACCAGGCCAGCTCTACAAAGGCTTAGAAATCACTCTCCACCCTACTACCACATTCCAAATCCAAAGGCTGGGATTATGAACATAGCCTTATACCAACAATGTGTGTGATTATTTCATCCCTGCCACAGAACCAAGACTTAGTGTTCCACTAGAGCCAACATCCCCAGCTGATGTGCAAACAAAACCCAAAATCTACAGGGCTCTAAGACGTCAATCCTCTTAATTAGCTTCAGGATTTTATGTGCCCTAGGCATGAAACAGCTTTGGCCACCAAGCCAGGCATCAAGCTAGGATGAACAAAGGACTGCCATTTGCTCTGCCCCTGACTGATATAAGAACAACACCACAAACAAGGTGCCTCTTTGCCCATTGCCAGGGGTGTGTCATAAACAGCTAAACCTGCCCAGCCAGCTAGATAGATTCTACCAATCCTCTTCCCCTTCCTCAAAAGATGCATTTTCTTTTTTCTTTTTGCTGGTAAAGTTGGTGGTAATTAGGTCAGCAAATCTCAATAGAACTAAAAGCTGTCAACAAGACCCAGTGGCATTAAGACAATGTCCTCAACCTTCTTCTAATTGTCTTATTTTTAAGGTAAACGTCATAGTACTGGCTGTCCTGGAACTAGCTCTATGGACCAGGGTGGCCTTGAACTTGCAGTGCTCAATCTACCTGTATCACTCACCACTAGTACTCTTCTCTCTTAAACCAGTCATATAGGAAACACACCAATCTCACCTGCTGAGCCAATTCACGTGTGGGTGCCAGAACCAAAGCCTGAGTGGCCTTTAGATCTAATTCAATCTGCTGCAGAATTGATATGGCAAATGTAGCTGTTTTCCCAGTCCCAGACTGGGCTTGAGCAATCACATCATAACCTACAACCAGATCAAGAATTAGATGTGCACCTTGGGATCAGAGGATATTTGAAACTTTACTTCATGACATCAGTAACAGAAAAAAGGTTGTAAATGAAATGGTAGAGGTTTGCAAACAAACTTTTGCCAAAATATTATGAACTCACAACAGCTTGTTAGACTAGATGTAGAGCAATAAAAACAAAGCCTCTAATTGGAAACAAACCCATGCATCCAAGGCATGACCTATGTACTAACAAAACTAAAAATCCAAGATCCAAGAAGGATGTTTCCTCCCGGTTGCTATGCCCACCAACTCCCTACCACTCTGTCCAGTCCAATCTAGTCCAGTACAAGTCTTACCCTTGATACAAGGAAGAATAGCTCGCTGCTGGATGGCAGAGGGCTTCTCAAAACCATAGGCATAAATACCACGGAGGAGGGACTCTGAGAGATTCATGTCATCAAAGCTATCCACAATCTCGTTCCAGTTACTCTGCAGGATTAGGAAAAAAAAAAACTTAGGCACTTCGAGTAACGTGTTTACACTAAAGCTGGAGTCACCTCATCCTACAGGTTGCTCTGTTCTACCACTCCAAATGTCTAAGGTCACTGTCACGCTAAGGAAGTGCCTGTTCTGACAAAATAAAGTGGGAACCGCAGGTTCTGGTCTTACCTCGATGACGCCTTCCGGCTCCATCCCGTCGGGGCCATTGTCTCTGGATCTGTTGATTCAAAGCACTAGTTTTGCTTCATGCCTTGACCAGAGTGGAAGCAACCAGCCCATTCCCGATCCAACTCCCATGTACTCCCAAAGAACCATCAAGAGGCACTTCATAGAGTGACGCTCCTTTAAGATCAAGCGGCTGTAAAGGACTTCATTCACACACACATTCACACTCTCTCTCTCTCTCTCATACACAAAACGCCGAGATGCGGTCTTTGCAGCCAGGCCCACATGTTCTAGGTCTGGTGGATCAAAGCGCGTGCACCTCCTGGATGAACACCAAGGCCACCGGAAGTCCCGCCTTCCACCTCCGAGTTCCGTGGGTGGGCCATCCCCTTCCCCCCACGTCATGCCGCCCGCGCCCTCCCCCACTCCCTCTGGCCGGCCCCCCTCCACAGTACCCGGATGTGGGAGGCCGCGGGCGGTGGCGGCCTCGCGCACAATGAGCCCCAGCCGCGCTCGCAAAGGGGGAGATTGCACAACAGACAAGCGAAACAGGCTGGGGGAGGGGAATCTCTCAAGCGGCCATGTGCTCATTCGCTCCGCCACTCGGCGGCGTCTCCCCCGCCATGGAACAATCCGCAACCCGCCCGCCCCCGTCGAGAAATGGCGTCGCCCTCCCATACCTCAGGCCGCTCACCCCCGAAGGAAAGTGGACCTGCCCATCCGCAGTTTGCCAATTGCCCGGCTTGTGCGGCAAAATGGACCCGCCCGCCAGGCGCCGGGTGGGTTCCCCGTGCCTCACGCGGCCGCTCCTCCGGGTTAGGCTCTTTCCTGGCCGTCAAGAAGGCCAGCGCCCTGATCGGCCGGTTTCTTCTTCCCCGACCCACATTCCAAGCGCGACGGAGGGACTCGCTGAAGACCGGGGCACCCCTGCTTGTCGCGAGTGGTACCGCCAGAACTCTCCGGAACCCTCGCTCGCACGCCCTGCCCGACACAGGGAGGCAGCCAGACCAGCCGGCTCCGGGCCGCGCAGCCGCCTCTTTCCCACGTTATGTCGCGACCTCATCTTGCCTTTCAGTATCCGAGCTTCGCGTACGGCGTTCCCACAGGCCGAGGCCTCGTGACGAAGCTCGCGCCCTCCGCCCTAGCCAGGTCGTCCTTCCCCGTAACCACACTGGGGTCAGCGGCGGCCATGGGAATCTCCCCCACCCCCCCAACCCCGGACGGTTCCTCCCGGCTCGGTTCTCCCGCAACCTGGTAGGTTCGGTGCGATGGGCCTCTCAACTTCCCCACGGCGGGCCCTTTGGAGGGAACTACGGGGTAAGTAGCCATAACCTTTTGCAAAAGCCTTTCTTACCGAGAATCCTGACTCGCAGACATGATCCTTAGAATCTAGGGCGGAGTGCCCGCCTATCGACAACTTATAGAGCGTCCGACCCCGCCCCAGCCATCGCATTGGCTTGGCCACCTCTGCCCCGCCTGCCGGCGCTCTGCAACTCGACGTGACGTTACTTTGTAGGCGCTTTAGTTCGGACGCCCTATTGGGTAGTTTGAAAGCCCATCATGGCCTAGCCCCGCCCTATGGCCTCATTGGCTGAAGGGTCCGCCTTTCTCGCTGGTGCGGAAGTGACATACTTAAGTCGGGCCTCGCGGCGGGGCAGCCATCTTGGAACCCAGCACCTTTACACGTGCGGAGGCGATCGTGCCTTAGTCATGTGGCTCAGCAGGTCCTATCAAGCGACGGGGGTGAGGCCTTAGCCTCCAGGAACTTCCGGGCAGTCTGGACTGCCACTTTCCTTTACCTGGGTTTTCTTTACAGGACAAGTTTTATTTATTCTTCCGTTCAGGAAAATATTGTAGCGATATCTCATTGGATAGTAAGTTTCCCCGACTGGAGACAAAAAGGATGGAACCCACTTTTGGGTTAAAGGGCATAGGGGGATAAGCTGTCAAGGATTGTCCCACTCAATCACTGGTTCATTTAGTATGTTTCCAGTTTCTCCTGGGCTTCCTTACATGAATAAGCGAGTCTTAATTCATATTTACTGCCATCTGCTCCCCGGGGATGGCATCTATCGAAAGCTGGACTCTCAAGCCCTGAAATGGGGATCGCTAACAGTGTTAGCTGGAAGAAGACCTGAGATAAAGCACAGCCACTATTTTGAGGCCCCTTAAGGAAGACCACCACTTGCATATCTTCAAAGGATCCTTTATTGACCAGAGCAGGACCGTGGCATTTTTATATATATTTATATATATAAAAAAAAGTTTGAAGATCGGGCAGGCAGTAATCCCTTTGCGCGTCCACCACCCCCACACTGTTTTCCTGCCCTCTGAACATGGAAGGAGGAATGGCTGCTCCACCTAGGCCACAAGGCAACATTCTCCTATAGAGGGAGAAAGAGGCTTGCTTTTATGTGGCCATTCCCTTCCCATCAGAAATCAATATACTCGCAGCAAAAAAAAACAAAATACAGAAACCAAACATTTAAATATGAAAATCCAAAGGGAATTGGGTAGAGAAACAAAAAGGAACTAGAGTTTCTTGGGAAGGGTCTCCCTTTCCCCTGCCCACTGATGGGCTAAGGGTCTGGGGTATGAGGCTCACACAGTGAGTTTGCAGTGACACAGTTCCTTGTAGATCTGACGACGGAGTTTGGGCATGTCCTGCTGGGTGAAGCTGAATGGCTGAGACAGGGCCAGGTGCTTGCAGTACTGGGTGTTAACAAAGTAGACCATGAGAACAGTTTACTGAGCACCCTCCCAAGTCAGGACCTGTGCTACACATTTCACACAAAATACATCTTAATTTCTCAGAAAATATCTGTTTCTCATACACACTGCCATTATAGACTAAGCCTGGGGCTTCAACAAGCCTACATAATATATCTGGTGTTTAAACTGGAAAATATATTTAGTTGGATGTTGGGAAGCCTCTATATCAGGACCAAAGCCAGAGATACAGTCCCAACTGAGGATGGAGAAAACCAATGAAACCAGGGTTTCTGTGCTAACACATAAAAGTACACCCTGCTGTGCAATCTGACTGAACCAAATGAGGCAAGAGCTACCAACAACCCCTAAGCTACTGACTGAGAGCTAAGAAGACCTTATCATTTGCTTACCTGTAATACAAAGGCACCACAGTCACTGTCATTATTCTGCCTGGCCACATTCTAGGGAATAGAAAGCAAGAATCTGTTCACTTGGAGACTCCTAGAGGTTACGAATTCAATTGCTGCCTCCTATCAAACTATTCCATTTTTCTCTGGAAACTCACCATTTTGAAGTAACCTTTCCAGCCCTGATGGAAGTCCAGTCGGTCTTTTTTGACTGCCTCTGCCTGTAGATACTTGGCAATATGCTATGTGGGCAAGAAAAAAGAAAGTGACACCTTAATCACCTGCCAGTGTAACACAGAGTGTGCTGGTGGGAAACATCACACCCACTCACTCCTCGGACTCCAAGCCCACGCTTCTTCCTGAAATGGCTTGCTGCCACATCTCCCTACAATTTTACTACTTGTTTCCCCACAACCTCCTCAAACCTTAGGGCAGCGGCGATTTAGAGTTCGCTGGGAGTCAAAATAGGTGATGGTACGTCGCCTTACATCAACTGAGATAAGGGACCAGTGCACCTCCAGATGGATGGGGATTAGCAGTAATTCCTTATTGAAGATGTCCACCTGGAAAGAGAGTGCTGGAAGTCAGCTACAACATAAAACCCTATTGATTGCCATGAGGATTCTAAAAAAAAAAATATGGAACAAGCAAAGGAGTTACAAAATATACATCATGGACTGTGAGGCAAGGCTCAGCATCAGATGCTATTACTTTTGGGAGGGTTTTTTTTCGGGGGTGGGGTGGGGGTGGGGACATACTCTTCAGACAATGTTGCCCTTTTGTTTAAGACTGGGTCCTTCCCTGACTTAGGACTCAGCAAATAACGTTGGTGGGCTGGCCAGCAAGTCCAAGGAATCTACTTACCTCCACTTCTGTAGCACTGAAAACAACTACCCCTGGCCTGGCTTTTTAGGTGGGGATCAAACTCCAGTCCTTGTATGCCCTCTATAGGTTGAGATATCTTCCTAACCCAGATATGCTCCTGCTTCTCAGGCCTGGCTGATATTGAGATATTTGATGGTGAAGAAAGACAGAAATAAGAAGGTAATATCAGAACACATGTGCCTTCTAATTTAGCACCTGGGAGGTAGAACTACGAGTTCAAGGCCAGCCTCTACTACATGCTCTGCTACCAGGTACATATACATTAAAGGAAAAAGTCTAGATAAGTACCCAGACTCTGGAGCTGCAGAAATGGCCAATTGGTTAAGAGCACTGGCTGTTCTTCCTGAGAAACAGAGTTCAATTCCCAGCACGCATATGGTGGCTCACAACCACCTGTAACTTGAGTTTCAGAGATCTGATGCCCATGTCTGGCCACTATGGCACTGCATTCATGTGGTGCTGAGACATTCACTCAGGCAAAACATATATACACATATAATAATTTAGAACAAACAAAAAACAGACTCAAGATTTTGGTGCCACACTGACATGGTTGAAACTCAGCTTCTACACTTACTAGTCCATGACCATGAGCAAGCTACTTAACCTTCTTTACCTTTCCTTATCTGGAAGAGGGAGAGAACAAAAGCACCTGCCCTCATTCACTATAGGGAGTACACTACTATCCACATAAAACACATGGCCTGAAAGAAATGCTCACACTATCACCAACTTCTTGTGTCACTCAAGACAGGAGGAAACTGCAAATTGGGAAAGTAATTGCTCAAGGTCACAGAAACATTTTTTTATTACATTGTTATTGGGAGGAGGGGAGTGGGTACACATGCCAGGGTGGAGGCATGGAGGTCAGAGGGCAAGCTGATTCTCTCCTTCCTTCCACCATGTGAGTCACACACAGGCTTGGCGGCACGCACCTTTTCATTTACCTCAATATACAGAAGGCTAAGTAAGGGTTTTTTGTTTTTGTTTGTTTTTAAACTGTATTTCACTCTTGCTTCTACTGGAAGAAACACGACTCAACAGGTCTCTGAGTAATTCTAAGCACAAAAATTAAATCCTGATGCTTGGACTGGGGTTGTGAGTGACAAAGAGCTCTAGCTCTAGCTACTATCTGGGGTAGGTCAGGGAATAGAAAGGCAGTGTTAGGTAACAGGAGGAAGACATGTGTGTGTTAGAACCAATGTTCCTTTGTCCTGTTATGAAAGGCCATGAAATTTCAGGACAGAGAAACCTATGGAAGTTCTTAAATACCTCCACATCTGCTCCTGACCCAATTTTTACTATCACTTAAGCCAAAAACCCAGATATAATTCTCCACTGATCTCTTCATCCCACATGAAACCTGCCAGAAATGTCTACAAGTTCTACCTTAACCTCCTCTCGCCTCTCCTTTTGGCACTCCAGCCCCAGGTACTTCACCTAGACTCCTTTCTCCTTCTATTCCATCACCGAATGGGGACACCAAACATGAAGCATCGCTAGTCTGGTAGGGTAAAGGTGTTTCCACCAAGCCTGACTTCCTGAGTTTGGGCTCTGGAACCCACATCACAGAAAGAAAGAACTGACTCTTACAAGCTGACTTCTAACCTCCACATCCACACCATGGCATGCACTTACATCCACACAAGACAATGTACACAGAACAACCTCTATCCTTGACAGTCTACCTTACGTGCCTCACATGATCTTCTCCAATTTTCTGTATTCAGCTACCACAGTCACTGTGTCAGAGTGGTCTCTTTCTCTGGGTCTGAAGCACTTGCTGCTCCTTTTGCCCAAGTGCTGCTCCCAGACCGCACAGGATGACTCCTATCACTCAAATGTGGAAGGCCTTAGCACAGATGTAAGGAAGACCTACACCCAATCCAAAGTCCCCATTCCCATGCTGTCACATTACTGTTGTAGGACATTTGCAGCACTCCAGGACCTGCTGTAATTTACCCTCATTCCATCACAGAAAGAACTCTTCTGATTTAATACTGCATCCTCAGTTTCTACAATCACGCCTGATACACAAGACCTTTAACCTTTGTAGAATGATGACCAGGATTGGGGAAAGGACTCATAGCAAGCAAAACTCTTATTACATTTTTTTTTAGAGACAAGGTGCTATATAAGTAGTTGTAAATTCGTAACTCACATTTTTGGTCCACCTCTTTACCCCATCATAACCCTTGGTACGGAGTTTATCATAGAAGAAGCTGTTGAAGAAATGCACCTGTGCCAAAGACACAAAGAAGCTGAACAGAATGAAAGACTTCAGCTTGCCCACAATTCCACCCTCCCAATCCACACACTGCTTCATAGTGTCCAACTGAAATGGCTCCAAGGATACCACCATACTCTTTTTAACCTTTTATAGATAAGTTCCTGTCCCAATTTAACCAAACAGGAAAACACTACAGATTGGCTTACAGATTTAAAATGAATAGATTAGCCCTTACTATCTCCCCCTCCAAACCGCAGACCTTAGGCTATATAAAATAGAAGAGATGAAAATGGATGTTTACCAAAAAATAAAAAGTAAAAATAAAAAGGAAAGGAAAAGGGAGGAGAAAACTGCTCAGAGTGCTGCAGAGATGGCTCAGTGGTTACCAACACTGACTGCTCTTCCAGAGGTCATGAGTTTTAATTCCAATCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCAGATGCCCCCTTCTCGTGTCTGAAGACAGCTACAGTGTACTCATATACATAAAATACTTTAAAAAAAAAAAACTGCTCAGGATTGCAAAGGTTCTGGTGACTAAAGAATCTGGTTAGTGTTGGGTCAGGAAAACTAGGGCTACACAGAAAAATCCTGCCAAAGGGGGGGGGGGGGGCGCGCAGTGGTGGCACACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGAATTTCTGAGTTCCAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCGAAAAAAAACAAAACAAAAAAGTGTGCTTGGACCTACCTTTTCAGGGACTGTGTCCATGACCAGATCTCCATACATGTTCATCACCTGTGGAAAAAATGGCAATTTGCTCTGGAGGATGTAGCATGGGGGTGGAGGGTTCCCTTACGCATCCACTCTCCCTCCAAAGGCCTTTTCAAGCTCTTTTATGTTCCTCTTCTTACCTGGTCATTGAGCCAGTTCTGTCCATATAAGGTACCCAAGTCATCCATGGTGAGCACGTGTCGCTTATAGGATACCCGGAAGCCCCTTACCATAGCGTTGCCTGGCATCCGCTGATAAGACTGGATCAGCTGTAGTACCAGACTCTTCCTGCATAGGCCAAATTTTTGTAATTATACAAGAGCTAATGTGGCTGGAGCAGCCAGAAATACCCACTACTACTGTCTAGAATAACTATGTAAAACAACTTTTCTTTTTCACAGGTTGTTTCGATGGTCTCCCACTCCCCACAAAGAGACACGAGAATGCTCATGGACAAGCTTTTCAATGTCTCTTAGTGTCCTACATAAAGATCCCCCCAGTTGTCTTACAGGGCTTGACACTTTGTCTGCAGCTTCCTCAGCTGCAGCTCTAGCTCTTACTTCCTCAAATCCACCACATTCTCTCCTCTACCTAAGGTAGGTCTCAGCCCTCCCTCAGTGCTCACCTTGAGGGTGTAGAGAACTCCTGCTGGAAAATGTCCTCCAACTTCTCTACAACTTCATCAGTGCTGAGAGGGATGAGGCTGCCATAAGTTTGAAGGAATTCATCTAAGATACCTAATGGAGGTAGGAGAGAGTAAGCGGGGGCCTTTAGACTCTATCGGAAAAGCTGGCCAGAAGGGGACTAAGTCTTCTGAAGACTCACTCTGCACACAGGTCACATGTTCCTCCCGAAGGGGGCTATGCTGGCCAGCTTTCTCCCCAGTCCGATCTGCCTCTTCTGCAATGCCCAAGTCAGAGCTCTGAAAAAGTTCCTGAGCCACGTGGTCTCCAATGCTGCACACATTACTGATGAGTATGCTGGCATCAGGGGGTGCCAGGCTGCGCTCCCCTTCAGGACCAGACAGTCCCCCAAAACCATTGGGTAGAGTACATGAGAGGAGGCCTATAAAGCACAGAAATAGGAATGAGAAACTGGCCGTGTAAAAGAACCAATGCATACAAATGATAAGACCACAGAACACAGACTGAAGCAGAGTCTAGCAATGGAAACCTTATGGAATACAGACACCACCACCCTACACACACACACACACACACACACACACACACACACACACACACATATGTGCGCGCCTAATGTAAGGACAGCCAGAGTTTATTAAAAAAAAAAAAAAAAAGAAGAAGAAGAAGAAAAAGTAGTAGGTCATCTTCAAAAAAGAGGAAGAATGCAAAAGCCTAGGATTTGGAGACCAGAAATCTCTGCTGCCAATATCTGCTTACCACCTAACAGTGCACAGTGAGTGAGGAAGGCTCAGTAGTAGTAAGGTTGGTAAGTTTTTAGCTTGAGTTCTCAAAGAGGAAATATTCTAAATAAAAATGTTAAAATCTACAAATGATATATTCCATAAGAACCATGAGTGTCCTATGGAGATCCACATGTCTAGGCCTTTTTCCGGCAGGAAGAAAGCCTTAGAATGGACAACATGATTTCCTAGAGCATAGATAGCTCTTTGTCATCTGCACTGAAGACCATAGGACATCTACTTATGTAGATGTTCCCAACACTGTGTCCCAGGTATCAGTCCTGCTAAAAATCAGAGTCCCCAGCTCCCACAAGATAGGATCTTTCTTTGCAGCCCAGGTGGGGCCTTGATTAATTGTTCCATCTTAGCCTCCAAAATCATAGGATTAGTGTGTGCCTAGACGGGCCTTTAAAATTAAGGCTTAAATCGGGTGGTGGCGGCGCACGCCTTTAGTCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAATGAGTTCCAGGACAGCCAGGACTACACAGAGAAACCCTGTCTCAAAAAAAAAACTAAATTAATTAATTAATTAATTAATAAAAATTAAGGCTTAAGATCATTTCACGGATATTCTGGAAGCTTTGCTCTGCTTTTCTTAGGCTCACCATGGCAACAAACTCCTGGTGCTCCAGGCTCATCACCCTTCCCATTTCCCACCTTACCCGAGTCAGGGTCCAGAGGAGACTTTGGGGTCCACCTTAGTCCATCTTCCTCCATGGGGGGCCCAGAGGGCACTGGTGGAGACCCTCTCATCCCATCCTCTGCCATGAGAGCACCTAGCAGACCCAGCCGGGGTGGGGGTAGCCCCCGGGGGGAGTCAAAACGACAGCAGGGTGATGGCACCTGTGGCGTTGCACCCCCTTCCTGGGGTGAGAGATGGTTCTTGGGGTGCGCGAGGTTCCGCCGCCGGCCTCGGTGGCGCCCCCAAAGCTTCCAGTGGAATGTCAGCGAGGTGCTTTTTGAGTAGAGCAGCATCTGGAAGGCTCTCATGGCTCGGCGCCGGCGCTGTGAGCAGGTTTTTCTATGAGAGGGTCGGAGAGCTCGAGAGCGCTGGGAGGCCCCCAGTTGGCCCCACCTAGGGGGTAGCCTCCAAGCTGCTACTTCCTCCTCATCTTCCTCCTCTTCCTCTTCCTCTTCTTCACTAGCTGAGGCATCAAAAGATGGCCGGGGGGCAGGGAGGCGTCTAGTTGGCACTGTGGTCCCAGACCCAGGATCTGGCCCAAAACCACCACCGGACTTGAGCCGGGGCTTAGGGGGTAGGGGCCAACGAAGACGCTCTCGCCTGGGATTTGAGTAAGTGGTGCCGGGTCCCGGAGGCTCAGGCCCCCAAGACCCGGTCCCCTGTATAGTCTCTTTCATCTTTCAGTACCCTGTAAAACAAAAGTTTGATTATCCAACTGAGGACACCCTACTCCTTTCTCCAAGATCGGAACTGTTCTTCAGCATTGTCCCTCTAATCTCAGATACAGCTAAAGACAAATCTAAAAACTCATAACTTCAGCTCTTCCCAG
G5 69485461 69485510 50 CTCTTTCCCACGTTATGTCGCGACCTCATCTTGCCTTTCAGTATCCGAGC
U5 69479444 69479493 50 AGTAAGAGATTGGTTGGCCACCCAGGTGCAGGCTCCTGCCCATGAGCCCT
D3 69478139 69478188 50 AAAGGGGAAATAAGGCAGTCTTGTAGAGGAGGCGGAGGTCTAGAAAAAGA
G3 69473925 69473974 50 GACCTGAGTGTATATAAGGGAATACCACAACAGAAATACATTTTAAACAT
G5_U5 69479444 69485510 6067 AGTAAGAGATTGGTTGGCCACCCAGGTGCAGGCTCCTGCCCATGAGCCCTCCCTCCCCCACCTCCCATTTCTCCTTACCTATAAGCGGTCCTAGCAAGATCAGACACACAGGGAGCCGCATGGCAGAGATGCTCAGACCAGCTAGGCTACACCAGTTCCTTCCTCAATCCAATCCCCTTTGCCTTCTCTTGGAAGAGGAAATGAAAAGCCTCACTTCCCTTAACTAAAATAATCCCACCCCAAACCTGACTCAGACACCTCAGCTTTAGCAACCCACTCAAGCCATTGGTTTTCACAATTAGGCTGTGATTGGCAGTGACGTTCTCAGTGGGCGGTACAAAGCCTTGGTTACCTCGTGAGAATGAGGCAGCTGACTCACACGGAACTTACCTAAGCAAAACTTGCTCTACTTGGGAGCTTACAATGCAGCAGAGAAATGGGAAGCCCTTTCCTCATTGGTAAGAAATGCAACCCCACCCATGCACTCCAATCCTAGCACAGGAGGCCGAAGGCAGATGTAAGAGGTCAGCTTAGCCTATTTATTTAGTTGCAGGACAGGAAGAGCTACAGAACAACCATCTCCCTACATCCCCAAGGTGAGTTGACACCTACATCATCTGGGCTAGGCCTAACCAACCAGTTGAATTTTTTTTTTTTGGTTTTTCAAGACAGGTATTTTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTTGTAGACCAGGCTAGCCTCGAACTCAGAAATCCACCTGCTTCTGCCTCCGGCAGAATGCTGGGATTAAAGGCTTGCGCCACCATACCCAGCCAGTTTAAGTCTTAATGCAGCAAGTTTCACTCATGTCTTGTGCCTAACACTGAGGCAAATTACCAAATGTTAGTAATGTGGGTCATTTGGTATTGCAGGAAGCAACATGGCAAATTCAGTAATCAACTAGTATGGGGGCAGGTGATCCACACTAGCAGGTAGGAGGGAAGGGAAAGAAACAAGAAGCCCAAACAGGCAGTTTCCAAGTAATTTTATTCAGAATTTTGTGTTTGTTTCCTGAATCAATAAATACTATACAAAACAATGTAAAAATGGCTACCATTTTCTCTCCCCTGCTCCCCTCACCAGGGGACAATTCCCTGGACAACCTCACTCAGGGGTTCTCCCTGTAGATTTGGTCCAGCAAATGAGGCCAGCCTTGTTTTTTAGCCCCTTGACTCACTTTTGGAGATTTGGCTGGGGTAGGAAAGCCTTTAGGAACGAGGTGACTAGGTTAGGGAAATGCATTAGTGTTTGGGGGGGGAAGGAGACGGCGCCTGGGGCAGAGCCTACCCCAAAGAAAAGGGTGTCTAAAATGTTCACGGTTCCTTCTTTTTGCCTCAAAAAGTGACATTTATTCATAGAGAAAAAAAACTGAAACAAAAAAAAAAAAAGCCAAAACAAAAACAAGATGTCCATCCCTTGGCTCCCTCCCCTCCCCCCTCCAGCTCTTCCTTAGCCCCACCCCAGGACTGAACCCTGGGCTAGGGCCAGGTCGCAGGACAGCCCCTCAAATGAGGTCAGCAACGTTGAGGGGCATCTCTTCAATGGAGGTGTTGTAGAAAGTCTCAATGTCTCGAAGAGTCCTCTTGTCTTCTTCGGTCACCATGTTAATAGCCACACCCTTACGACCAAACCGACCACCTCGACCGATTCTGAGGGGGGTAAAAAGGATGATGGAACACTTGGGTTTCAGCATAGGGGTTGTTTAGTCTGTCAGACCTAGACTTACCTGTGGATGTAGTTTTCCCTGTTGGTGGGAAGGTCATAGTTGATGACTAAGGAGACCTGCTGCACATCAATGCCTCTGGCCTAGGTCAGGAAAGAATATAGCCATCAGAGGATACAATCTATCCTAATTAAGTAGGCATACATGTAGGCAGCCAGAGGAGGGCAAAGGAAACAAGAGTTTCTTGTCCACCAGAGACCTCAGGCACGCCTGGTTTTCTTCCAAGTTGCTACGTTCCTGAAAAGGGCACACAGTCAGCCCTTTGGAGAGGGAATCACCTTGGACTAACTTAACTTGTCTTCCTTTCTTTCCCTGAAAGCATCTACTCACCAACAGGTCAGTGGTAATTAATACTCTGCTAGAGCCAGACCGGAACTCCCTCATGATCACATCTCGTTCCTTTTGGTCCATATCTCCGTGCTGGAAAACAAAGAGGTAGAAGCATTTGGCACAAGGCTCCCAACACAGACAGACACACAGAGACACATAGCCATTAAAACTCACCATGGCAGAAACAGTGAAATCTCGGGCATGCATCTTCTCGGTGAGCCAGTCCACCTTCCTTCTGGTGTTGATAAAGATGACTGCCTGGGTGATGGTCAGCGTCTCATACAAGTCACACAATGTGTCAAGCTTCCACTCCTGGAGATTCAGAAGTCAGGGGTTACACTCAACAACTTACTACCAGGTCTGCCTCCTGCACTGGGCCTCACCTCTCGTTCCACATTGATGTAGAATTGGCGGATACCCTCCAGGGTCAATTCTTCCTTCTTGACAAGAATCCGAATAGGGTCTCTCATAAATTTCTTGGTCACCTCAAGGACATCAGAAGGCATTGTAGCAGACAACAAAACTACCTAATGGGGAAAACAGCAGCCATGATGAGGGCACTGTACATTCCTCAGATCACAACCAAGCCCCTTGTGTCCTATCAACCTCGCCATTTGTCCACCTGTGTGTTGCTGTTGAGCTTCTGGAATATGTCATAGATCTGATCCTTGAACCCTCGGCTTAACATTTCATCTGCTTCATCCAGTACGAACATCTTGATGTATTTGGGGGCTAGAAGGCAGAAGAAAAAACACCAACACATAGTGATCAGACAAATGTGAAATACATGGAAATCTCTTGGTAAGAGGGCAGTCAAAGGGCAGATGTCTGCTCTCAGAATACAAGGACTGATCCTTTGCCCAAAGCTTCCCTGATAAGCCAGGCAAAAGCCCTGGTAAGTAGAACACTACCTGGGCTAAGGTAACAACAGGGAAGCCAGGCTCAGATGACACGCATGGGGTTCATCACAGAGCAACTCAGTTCTAAACTAAAGGAAAACTTGCATCCAAGAAAATGACATGTGGGAATGCCCACCAACTGTTACATGGTACTCACACAGGTATCTCCGGTTAAGCATGTCAAACACCCGGCCAGGGGTACCCACGATGATATGGGGAGCTTCCATCTGCAGCTTCTGCACCTCAGCACGCACATTGGTGCCCCCAATGCAGGCATGACAAGAGGCACCCATGTAGTCTCCTAATGCCATAACCACCTTTTGTATCTGAATGCAGAAGAACATCTACATTAACTCGGGCGGTACCCACGTAATTCTCTCTCAATCCCAGCACTACAACCACAAATGGCAGTGCTGAATCCCACCACACAGGTTCACAGTAATTTCCCCACCCCTACATGCAGCCTTGTAAAAAAACACCAGGCCAGCTCTACAAAGGCTTAGAAATCACTCTCCACCCTACTACCACATTCCAAATCCAAAGGCTGGGATTATGAACATAGCCTTATACCAACAATGTGTGTGATTATTTCATCCCTGCCACAGAACCAAGACTTAGTGTTCCACTAGAGCCAACATCCCCAGCTGATGTGCAAACAAAACCCAAAATCTACAGGGCTCTAAGACGTCAATCCTCTTAATTAGCTTCAGGATTTTATGTGCCCTAGGCATGAAACAGCTTTGGCCACCAAGCCAGGCATCAAGCTAGGATGAACAAAGGACTGCCATTTGCTCTGCCCCTGACTGATATAAGAACAACACCACAAACAAGGTGCCTCTTTGCCCATTGCCAGGGGTGTGTCATAAACAGCTAAACCTGCCCAGCCAGCTAGATAGATTCTACCAATCCTCTTCCCCTTCCTCAAAAGATGCATTTTCTTTTTTCTTTTTGCTGGTAAAGTTGGTGGTAATTAGGTCAGCAAATCTCAATAGAACTAAAAGCTGTCAACAAGACCCAGTGGCATTAAGACAATGTCCTCAACCTTCTTCTAATTGTCTTATTTTTAAGGTAAACGTCATAGTACTGGCTGTCCTGGAACTAGCTCTATGGACCAGGGTGGCCTTGAACTTGCAGTGCTCAATCTACCTGTATCACTCACCACTAGTACTCTTCTCTCTTAAACCAGTCATATAGGAAACACACCAATCTCACCTGCTGAGCCAATTCACGTGTGGGTGCCAGAACCAAAGCCTGAGTGGCCTTTAGATCTAATTCAATCTGCTGCAGAATTGATATGGCAAATGTAGCTGTTTTCCCAGTCCCAGACTGGGCTTGAGCAATCACATCATAACCTACAACCAGATCAAGAATTAGATGTGCACCTTGGGATCAGAGGATATTTGAAACTTTACTTCATGACATCAGTAACAGAAAAAAGGTTGTAAATGAAATGGTAGAGGTTTGCAAACAAACTTTTGCCAAAATATTATGAACTCACAACAGCTTGTTAGACTAGATGTAGAGCAATAAAAACAAAGCCTCTAATTGGAAACAAACCCATGCATCCAAGGCATGACCTATGTACTAACAAAACTAAAAATCCAAGATCCAAGAAGGATGTTTCCTCCCGGTTGCTATGCCCACCAACTCCCTACCACTCTGTCCAGTCCAATCTAGTCCAGTACAAGTCTTACCCTTGATACAAGGAAGAATAGCTCGCTGCTGGATGGCAGAGGGCTTCTCAAAACCATAGGCATAAATACCACGGAGGAGGGACTCTGAGAGATTCATGTCATCAAAGCTATCCACAATCTCGTTCCAGTTACTCTGCAGGATTAGGAAAAAAAAAAACTTAGGCACTTCGAGTAACGTGTTTACACTAAAGCTGGAGTCACCTCATCCTACAGGTTGCTCTGTTCTACCACTCCAAATGTCTAAGGTCACTGTCACGCTAAGGAAGTGCCTGTTCTGACAAAATAAAGTGGGAACCGCAGGTTCTGGTCTTACCTCGATGACGCCTTCCGGCTCCATCCCGTCGGGGCCATTGTCTCTGGATCTGTTGATTCAAAGCACTAGTTTTGCTTCATGCCTTGACCAGAGTGGAAGCAACCAGCCCATTCCCGATCCAACTCCCATGTACTCCCAAAGAACCATCAAGAGGCACTTCATAGAGTGACGCTCCTTTAAGATCAAGCGGCTGTAAAGGACTTCATTCACACACACATTCACACTCTCTCTCTCTCTCTCATACACAAAACGCCGAGATGCGGTCTTTGCAGCCAGGCCCACATGTTCTAGGTCTGGTGGATCAAAGCGCGTGCACCTCCTGGATGAACACCAAGGCCACCGGAAGTCCCGCCTTCCACCTCCGAGTTCCGTGGGTGGGCCATCCCCTTCCCCCCACGTCATGCCGCCCGCGCCCTCCCCCACTCCCTCTGGCCGGCCCCCCTCCACAGTACCCGGATGTGGGAGGCCGCGGGCGGTGGCGGCCTCGCGCACAATGAGCCCCAGCCGCGCTCGCAAAGGGGGAGATTGCACAACAGACAAGCGAAACAGGCTGGGGGAGGGGAATCTCTCAAGCGGCCATGTGCTCATTCGCTCCGCCACTCGGCGGCGTCTCCCCCGCCATGGAACAATCCGCAACCCGCCCGCCCCCGTCGAGAAATGGCGTCGCCCTCCCATACCTCAGGCCGCTCACCCCCGAAGGAAAGTGGACCTGCCCATCCGCAGTTTGCCAATTGCCCGGCTTGTGCGGCAAAATGGACCCGCCCGCCAGGCGCCGGGTGGGTTCCCCGTGCCTCACGCGGCCGCTCCTCCGGGTTAGGCTCTTTCCTGGCCGTCAAGAAGGCCAGCGCCCTGATCGGCCGGTTTCTTCTTCCCCGACCCACATTCCAAGCGCGACGGAGGGACTCGCTGAAGACCGGGGCACCCCTGCTTGTCGCGAGTGGTACCGCCAGAACTCTCCGGAACCCTCGCTCGCACGCCCTGCCCGACACAGGGAGGCAGCCAGACCAGCCGGCTCCGGGCCGCGCAGCCGCCTCTTTCCCACGTTATGTCGCGACCTCATCTTGCCTTTCAGTATCCGAGC
D3_G3 69473925 69478188 4264 GACCTGAGTGTATATAAGGGAATACCACAACAGAAATACATTTTAAACATTTGGGACTGGAAAGATGACTTAGTGGTTAAGAGCACATCTCTGCTCTTGCAGAGAAGATCTGAATTCAATTTTTAGCATCCTTCTCCAGTGACTCACAAATGCCCGTAGCTCCAGCTCCAGTGGCATCTTCAGGCCCTTGCAGTCATGTATAGTATACATATACACACACATATACAAGTGAAAAGACACACATAAAAAAAAAAAATCTACATTTCAAAACAACCCTGGCTGGCGAGATGGCTTAGTGGGTAAGAGAGCTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCCATAATGAGATCTGACGCCCTCTTTTGGTGTGTCTGAAGTCAGCTACGGTGTACTTATGTATAATAATAAATAAATATTAAAAAATAAATAAAAAATAAAACAACCCTATTTTGTGTGTGAGCACATAGGTGCATGTGTTCAGGTCAGAGACTTTGAGGAGCCAGTTCTCCCTTTTTGCCTTTCTGTGGGTTCCGGGAATTGTACCCAGGTTGCCAGCCTTGCAAGCCACCCCTCCAGTCCCACAGGCGTTCCCTGACTCTTTTCTCTCCCCCCCCACCCCATTCCCACATTCATACATTCCTGAACCTTCAGGTTGTCCCCACTCTTCCAGGACATTTATCCTTGTTCTTCCACTATCTCTATCATTTACTTCTTTTTTTTAAAGATTTATTTATTTATTTACTTTATGTGTGTGAGTACATTGTAGCTATCTATCTTCAGACACACCAGAAGAGGGCATTGGATCCCATTACAGATGGTTGTAGGCCACCATGTGGTTGCTGGGAATTAAACTCAGAACCTCTGGGAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCTATCATTTACTTCTTATCTTGGTTTTTCCAGACAAGGCTGCTCTGTGTAGCCAGCCCTGGTTGTATTGGAACTCATCCAGTTGCCTAGGCTGTCCTTGAACTCCCGCCTCTGGGTCCCTCCCAAGGGCTGGGATTAAAGGTGTGGGCCACAGTTCCTGGCAATTTCTCTAATTTTTTTTAAAAAACATTTTTCTTTCAAACCCTGTGTCCAGGGCTGATTTTCAATAGATTGCAGCGAGTGAGCTGAGCTGCTGCCTACAAAACCCTGATCCTGGCAATCTCTCTACCACTGAATCTTTGACCTGGTGGGCATTTGGCCCAGGAAGGCGTCTTGACTATTGTAAGCCAAAAGTCACTTAGAATAGAGAGATGGAGAAGGCTTATCAAAGGCCTTTGTAAAGAAAAAGGAAAGGAAAAGTGCTATACTCCCAACACTCTAGTGACTGAGGCAGGAGGACTGTTGCCAGTTCAAGGGCAGTCTGTGCCACATAGTAAATTCCAGAAGCTGGTGCTGGAGAGAGGGGATAAAAAAAAAAATTTGTGAGCCTCTGTCAGTTGAGTGCTTGGGGCGAAAGGAGGCCTACATGCCTGGCTGGGGTTTTAATTTTGTTTTATAAAATACGAGTTTTCCGCCGAGGATTGGTGGCACACACCTTTAATCCCAGCATTTGGGAGACAGAGTCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGCGAGTTCCAGGTCAGCCAGAGCTATACCCTGTCGGGGGGGGGGGGGGGGGTACGACAAAAAAGCTCCGAGTTTTCCAGCCTGGGGCTAGAGCCTGGTTAGCAGAGTAGCACATGCCGCCCTGAGTTCGACTCCCAGCCCAGAAAGGGATGAGGGTTGGGTACAGACTTCCGAGATTGTAAAACACAAATTTAACTTTTTTTCGGGAGACACCCCTTCATGCCCAAATATGGCACTTTTCCTATGCAGGGCCCCAAACACTTCCGCCCTCGTCAGAACCGCCTTCTGCCCAGCTTCGCGGTGACATTAATCGCCACTGTCACGCCAACTTACGGTTCAAGGCTGCTCCAGCTAGACCTTGAAGGCTGAAATAAAACTCACCATGAAGCAAGTCCCATTGCACGAAGAGCTGGTCGTAACATTTCTCAGGTAAAAGAATTGGCACCAGCAGCCCTTTGAACGGCCCGTCGGCCTCCCCCGCCATGTTGGAAAGCTAAGCTTCCGCCAGGCGGGACAACCCCCGCCATTTATCCGCGCCGCGCATGCGCGCCGCGCACACCCCGCCCTGCTGTCCCCGAGGCCAGGGCTGCTCTTCCCTCTCCGTGATGCTCGCCCGCCTCCTCTAGGGGACACAGGTCTCCTTCCCAGGCAGGCTTTTGTGCGCGCCTTGACGTTCGAATTTTAAAGCGTGTCCGCGTTTGGCGCCTGCGCTGTTAGGACTTCCTCACTTTTGTTTACGCTCTTGTTCTGAAAGCAAGGTCCATGCTGCCCCCTCGCCCTGTCCCCCCTGCATGTACGCCATCTTGTCTAATCTCGGCCAACTTGATAGTGTTTGAAGTTGAAAGGGAAAAGAGTTCGAGTCTTCAAAATGGCGCTAGCAGAAGCACTGCAGCTCTCTTTATCTTTCCTCTTGGTTTCTCCAGAGGGAATAGAGCCGCAAAAGAGCCATTCCGAGCTGGGCCTTCTTTCTGGTCCCCTGCTTCGTCCTCTGTCCAGATGTTAAGAGGATGACGGTGGGGCTGGTGAGATGGCTCAGCGGTTAAGAGCGCCGATTGCTCTTCCAAAGGTACTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAGCCATCCGTAAGGGGCGAGCTCCGCTGCAGGAGAGCAACCCCTGACACAACAGGGGACCTCAGTCTGCTGTGTCTAGGTGGGAACCCAGAGGGTGCGAGCAAAATTCCAGTATTTGTCTGGGAAAGGGCCCCTAGGGTTAGGCGAAGAGAGCCATCTACATTCCACCACACTGCCAGGACACCTACTCTTGGTTCAGGCTGTAGGGCATTCCTAAACTGTTTCTCAGTTCCTTGTTTTTGGGGGTGAGGGGAATGTAGTTGCTGGTCAGGGCATAATGTCACATGTACCTCTGCTGTGTGGGGGCTCTGGTCCAAGAATTTCTGTAACCTCATGGGACTGTTAAATTGGAAAGGCACCCATCCTTGGCTCCCATCCGTTGAACCATGTCCTACTATAAACAGTAGAATTTATACTTTGGTACAGTGGGTGGCTGTCTGAAAAATCCCTTTTTATATCTGGACAAGGGCAGATTGCAATTGCCACCGCTCCCTCTCCTTCTGGTACTCGGGGATGTGTTTGCGAGGCCTGAAGTTGTTCCTCGTAGCACAGCCTCATAGAAGTCGGCTGCACCAGTGGGCTCCTCAGTGAACTAGCCCCGGCCACAGTGCACATGGAATCTCATTGTTCAGTCACCACTTTTGAAATAAATTAATACAGCCACCTACTCATATTTTAGTTGTGTTGTACCTAGCTGCGCCCCGAGGGTCAGCAACAGGGTGTCAGGTCGGAATGATTCATTCTGTAAGGGACTAGGCAGCCATTGGCCCCAGAGGGAGGAGGGAATTTTGGCAGCTTCACCAGCAGTCACAGGACATTGAGGGATGAACCAATGAAGGCATTTGGTCACTCTCTGGTACTTTTGTCCCTTCTTGCCAGCTGTCTCTTGGTGACTCAGCCACGGGAAGGCACAGGAAGGCATATGACAAGAAACTCGTGGCTTTTAGCCCCGGCAGGACAAGGCAAGCCAAGAGAAAAGATTTCATTAAGTGTTTGTACTCTTAATGAGGAAAGAAAGGAGTAGTAGGTACCATTCATGTTTATTGATTCCCCACCCCTATTATAAAATCTCTTCATTGTGTTCCTAAAGACAGAGAAGGAAGGTAACTGTTGAGTCAGTGGCATGGTGAAGAGATGAGGCGCTCCTTGGTGGCTTACACAGTGGACTGGGGCAGATGCTCAGAGGGGCTGGTAGGTTGATTGTCGTCTGCGGGTGATGCAGAAGGCGATGAGCACCAGGGTGAGGAGGCCGAGGAGGACCAGGCCAATGATGAGAGGCAGCAAGAGGGACTGGTCACGGTTGCAAGAGAAACCTGGCAGAATAATGGGATCCCTGAGAATTGCTGCAGTGGTGGACGGGCTAAAGGTGGGAGGTGGGGGAGGACGGAAGAGGAAAGGGGATGAAGAAAGGCTGAGGAGCCAACCCATAGGTGAGAGCAGTCAGCAAAGGGGAAATAAGGCAGTCTTGTAGAGGAGGCGGAGGTCTAGAAAAAGA
U5_15 69479444 69494493 15050 AGTAAGAGATTGGTTGGCCACCCAGGTGCAGGCTCCTGCCCATGAGCCCTCCCTCCCCCACCTCCCATTTCTCCTTACCTATAAGCGGTCCTAGCAAGATCAGACACACAGGGAGCCGCATGGCAGAGATGCTCAGACCAGCTAGGCTACACCAGTTCCTTCCTCAATCCAATCCCCTTTGCCTTCTCTTGGAAGAGGAAATGAAAAGCCTCACTTCCCTTAACTAAAATAATCCCACCCCAAACCTGACTCAGACACCTCAGCTTTAGCAACCCACTCAAGCCATTGGTTTTCACAATTAGGCTGTGATTGGCAGTGACGTTCTCAGTGGGCGGTACAAAGCCTTGGTTACCTCGTGAGAATGAGGCAGCTGACTCACACGGAACTTACCTAAGCAAAACTTGCTCTACTTGGGAGCTTACAATGCAGCAGAGAAATGGGAAGCCCTTTCCTCATTGGTAAGAAATGCAACCCCACCCATGCACTCCAATCCTAGCACAGGAGGCCGAAGGCAGATGTAAGAGGTCAGCTTAGCCTATTTATTTAGTTGCAGGACAGGAAGAGCTACAGAACAACCATCTCCCTACATCCCCAAGGTGAGTTGACACCTACATCATCTGGGCTAGGCCTAACCAACCAGTTGAATTTTTTTTTTTTGGTTTTTCAAGACAGGTATTTTGTGTAGCCTTGGCTGTCCTGGAACTCACTTTTGTAGACCAGGCTAGCCTCGAACTCAGAAATCCACCTGCTTCTGCCTCCGGCAGAATGCTGGGATTAAAGGCTTGCGCCACCATACCCAGCCAGTTTAAGTCTTAATGCAGCAAGTTTCACTCATGTCTTGTGCCTAACACTGAGGCAAATTACCAAATGTTAGTAATGTGGGTCATTTGGTATTGCAGGAAGCAACATGGCAAATTCAGTAATCAACTAGTATGGGGGCAGGTGATCCACACTAGCAGGTAGGAGGGAAGGGAAAGAAACAAGAAGCCCAAACAGGCAGTTTCCAAGTAATTTTATTCAGAATTTTGTGTTTGTTTCCTGAATCAATAAATACTATACAAAACAATGTAAAAATGGCTACCATTTTCTCTCCCCTGCTCCCCTCACCAGGGGACAATTCCCTGGACAACCTCACTCAGGGGTTCTCCCTGTAGATTTGGTCCAGCAAATGAGGCCAGCCTTGTTTTTTAGCCCCTTGACTCACTTTTGGAGATTTGGCTGGGGTAGGAAAGCCTTTAGGAACGAGGTGACTAGGTTAGGGAAATGCATTAGTGTTTGGGGGGGGAAGGAGACGGCGCCTGGGGCAGAGCCTACCCCAAAGAAAAGGGTGTCTAAAATGTTCACGGTTCCTTCTTTTTGCCTCAAAAAGTGACATTTATTCATAGAGAAAAAAAACTGAAACAAAAAAAAAAAAAGCCAAAACAAAAACAAGATGTCCATCCCTTGGCTCCCTCCCCTCCCCCCTCCAGCTCTTCCTTAGCCCCACCCCAGGACTGAACCCTGGGCTAGGGCCAGGTCGCAGGACAGCCCCTCAAATGAGGTCAGCAACGTTGAGGGGCATCTCTTCAATGGAGGTGTTGTAGAAAGTCTCAATGTCTCGAAGAGTCCTCTTGTCTTCTTCGGTCACCATGTTAATAGCCACACCCTTACGACCAAACCGACCACCTCGACCGATTCTGAGGGGGGTAAAAAGGATGATGGAACACTTGGGTTTCAGCATAGGGGTTGTTTAGTCTGTCAGACCTAGACTTACCTGTGGATGTAGTTTTCCCTGTTGGTGGGAAGGTCATAGTTGATGACTAAGGAGACCTGCTGCACATCAATGCCTCTGGCCTAGGTCAGGAAAGAATATAGCCATCAGAGGATACAATCTATCCTAATTAAGTAGGCATACATGTAGGCAGCCAGAGGAGGGCAAAGGAAACAAGAGTTTCTTGTCCACCAGAGACCTCAGGCACGCCTGGTTTTCTTCCAAGTTGCTACGTTCCTGAAAAGGGCACACAGTCAGCCCTTTGGAGAGGGAATCACCTTGGACTAACTTAACTTGTCTTCCTTTCTTTCCCTGAAAGCATCTACTCACCAACAGGTCAGTGGTAATTAATACTCTGCTAGAGCCAGACCGGAACTCCCTCATGATCACATCTCGTTCCTTTTGGTCCATATCTCCGTGCTGGAAAACAAAGAGGTAGAAGCATTTGGCACAAGGCTCCCAACACAGACAGACACACAGAGACACATAGCCATTAAAACTCACCATGGCAGAAACAGTGAAATCTCGGGCATGCATCTTCTCGGTGAGCCAGTCCACCTTCCTTCTGGTGTTGATAAAGATGACTGCCTGGGTGATGGTCAGCGTCTCATACAAGTCACACAATGTGTCAAGCTTCCACTCCTGGAGATTCAGAAGTCAGGGGTTACACTCAACAACTTACTACCAGGTCTGCCTCCTGCACTGGGCCTCACCTCTCGTTCCACATTGATGTAGAATTGGCGGATACCCTCCAGGGTCAATTCTTCCTTCTTGACAAGAATCCGAATAGGGTCTCTCATAAATTTCTTGGTCACCTCAAGGACATCAGAAGGCATTGTAGCAGACAACAAAACTACCTAATGGGGAAAACAGCAGCCATGATGAGGGCACTGTACATTCCTCAGATCACAACCAAGCCCCTTGTGTCCTATCAACCTCGCCATTTGTCCACCTGTGTGTTGCTGTTGAGCTTCTGGAATATGTCATAGATCTGATCCTTGAACCCTCGGCTTAACATTTCATCTGCTTCATCCAGTACGAACATCTTGATGTATTTGGGGGCTAGAAGGCAGAAGAAAAAACACCAACACATAGTGATCAGACAAATGTGAAATACATGGAAATCTCTTGGTAAGAGGGCAGTCAAAGGGCAGATGTCTGCTCTCAGAATACAAGGACTGATCCTTTGCCCAAAGCTTCCCTGATAAGCCAGGCAAAAGCCCTGGTAAGTAGAACACTACCTGGGCTAAGGTAACAACAGGGAAGCCAGGCTCAGATGACACGCATGGGGTTCATCACAGAGCAACTCAGTTCTAAACTAAAGGAAAACTTGCATCCAAGAAAATGACATGTGGGAATGCCCACCAACTGTTACATGGTACTCACACAGGTATCTCCGGTTAAGCATGTCAAACACCCGGCCAGGGGTACCCACGATGATATGGGGAGCTTCCATCTGCAGCTTCTGCACCTCAGCACGCACATTGGTGCCCCCAATGCAGGCATGACAAGAGGCACCCATGTAGTCTCCTAATGCCATAACCACCTTTTGTATCTGAATGCAGAAGAACATCTACATTAACTCGGGCGGTACCCACGTAATTCTCTCTCAATCCCAGCACTACAACCACAAATGGCAGTGCTGAATCCCACCACACAGGTTCACAGTAATTTCCCCACCCCTACATGCAGCCTTGTAAAAAAACACCAGGCCAGCTCTACAAAGGCTTAGAAATCACTCTCCACCCTACTACCACATTCCAAATCCAAAGGCTGGGATTATGAACATAGCCTTATACCAACAATGTGTGTGATTATTTCATCCCTGCCACAGAACCAAGACTTAGTGTTCCACTAGAGCCAACATCCCCAGCTGATGTGCAAACAAAACCCAAAATCTACAGGGCTCTAAGACGTCAATCCTCTTAATTAGCTTCAGGATTTTATGTGCCCTAGGCATGAAACAGCTTTGGCCACCAAGCCAGGCATCAAGCTAGGATGAACAAAGGACTGCCATTTGCTCTGCCCCTGACTGATATAAGAACAACACCACAAACAAGGTGCCTCTTTGCCCATTGCCAGGGGTGTGTCATAAACAGCTAAACCTGCCCAGCCAGCTAGATAGATTCTACCAATCCTCTTCCCCTTCCTCAAAAGATGCATTTTCTTTTTTCTTTTTGCTGGTAAAGTTGGTGGTAATTAGGTCAGCAAATCTCAATAGAACTAAAAGCTGTCAACAAGACCCAGTGGCATTAAGACAATGTCCTCAACCTTCTTCTAATTGTCTTATTTTTAAGGTAAACGTCATAGTACTGGCTGTCCTGGAACTAGCTCTATGGACCAGGGTGGCCTTGAACTTGCAGTGCTCAATCTACCTGTATCACTCACCACTAGTACTCTTCTCTCTTAAACCAGTCATATAGGAAACACACCAATCTCACCTGCTGAGCCAATTCACGTGTGGGTGCCAGAACCAAAGCCTGAGTGGCCTTTAGATCTAATTCAATCTGCTGCAGAATTGATATGGCAAATGTAGCTGTTTTCCCAGTCCCAGACTGGGCTTGAGCAATCACATCATAACCTACAACCAGATCAAGAATTAGATGTGCACCTTGGGATCAGAGGATATTTGAAACTTTACTTCATGACATCAGTAACAGAAAAAAGGTTGTAAATGAAATGGTAGAGGTTTGCAAACAAACTTTTGCCAAAATATTATGAACTCACAACAGCTTGTTAGACTAGATGTAGAGCAATAAAAACAAAGCCTCTAATTGGAAACAAACCCATGCATCCAAGGCATGACCTATGTACTAACAAAACTAAAAATCCAAGATCCAAGAAGGATGTTTCCTCCCGGTTGCTATGCCCACCAACTCCCTACCACTCTGTCCAGTCCAATCTAGTCCAGTACAAGTCTTACCCTTGATACAAGGAAGAATAGCTCGCTGCTGGATGGCAGAGGGCTTCTCAAAACCATAGGCATAAATACCACGGAGGAGGGACTCTGAGAGATTCATGTCATCAAAGCTATCCACAATCTCGTTCCAGTTACTCTGCAGGATTAGGAAAAAAAAAAACTTAGGCACTTCGAGTAACGTGTTTACACTAAAGCTGGAGTCACCTCATCCTACAGGTTGCTCTGTTCTACCACTCCAAATGTCTAAGGTCACTGTCACGCTAAGGAAGTGCCTGTTCTGACAAAATAAAGTGGGAACCGCAGGTTCTGGTCTTACCTCGATGACGCCTTCCGGCTCCATCCCGTCGGGGCCATTGTCTCTGGATCTGTTGATTCAAAGCACTAGTTTTGCTTCATGCCTTGACCAGAGTGGAAGCAACCAGCCCATTCCCGATCCAACTCCCATGTACTCCCAAAGAACCATCAAGAGGCACTTCATAGAGTGACGCTCCTTTAAGATCAAGCGGCTGTAAAGGACTTCATTCACACACACATTCACACTCTCTCTCTCTCTCTCATACACAAAACGCCGAGATGCGGTCTTTGCAGCCAGGCCCACATGTTCTAGGTCTGGTGGATCAAAGCGCGTGCACCTCCTGGATGAACACCAAGGCCACCGGAAGTCCCGCCTTCCACCTCCGAGTTCCGTGGGTGGGCCATCCCCTTCCCCCCACGTCATGCCGCCCGCGCCCTCCCCCACTCCCTCTGGCCGGCCCCCCTCCACAGTACCCGGATGTGGGAGGCCGCGGGCGGTGGCGGCCTCGCGCACAATGAGCCCCAGCCGCGCTCGCAAAGGGGGAGATTGCACAACAGACAAGCGAAACAGGCTGGGGGAGGGGAATCTCTCAAGCGGCCATGTGCTCATTCGCTCCGCCACTCGGCGGCGTCTCCCCCGCCATGGAACAATCCGCAACCCGCCCGCCCCCGTCGAGAAATGGCGTCGCCCTCCCATACCTCAGGCCGCTCACCCCCGAAGGAAAGTGGACCTGCCCATCCGCAGTTTGCCAATTGCCCGGCTTGTGCGGCAAAATGGACCCGCCCGCCAGGCGCCGGGTGGGTTCCCCGTGCCTCACGCGGCCGCTCCTCCGGGTTAGGCTCTTTCCTGGCCGTCAAGAAGGCCAGCGCCCTGATCGGCCGGTTTCTTCTTCCCCGACCCACATTCCAAGCGCGACGGAGGGACTCGCTGAAGACCGGGGCACCCCTGCTTGTCGCGAGTGGTACCGCCAGAACTCTCCGGAACCCTCGCTCGCACGCCCTGCCCGACACAGGGAGGCAGCCAGACCAGCCGGCTCCGGGCCGCGCAGCCGCCTCTTTCCCACGTTATGTCGCGACCTCATCTTGCCTTTCAGTATCCGAGCTTCGCGTACGGCGTTCCCACAGGCCGAGGCCTCGTGACGAAGCTCGCGCCCTCCGCCCTAGCCAGGTCGTCCTTCCCCGTAACCACACTGGGGTCAGCGGCGGCCATGGGAATCTCCCCCACCCCCCCAACCCCGGACGGTTCCTCCCGGCTCGGTTCTCCCGCAACCTGGTAGGTTCGGTGCGATGGGCCTCTCAACTTCCCCACGGCGGGCCCTTTGGAGGGAACTACGGGGTAAGTAGCCATAACCTTTTGCAAAAGCCTTTCTTACCGAGAATCCTGACTCGCAGACATGATCCTTAGAATCTAGGGCGGAGTGCCCGCCTATCGACAACTTATAGAGCGTCCGACCCCGCCCCAGCCATCGCATTGGCTTGGCCACCTCTGCCCCGCCTGCCGGCGCTCTGCAACTCGACGTGACGTTACTTTGTAGGCGCTTTAGTTCGGACGCCCTATTGGGTAGTTTGAAAGCCCATCATGGCCTAGCCCCGCCCTATGGCCTCATTGGCTGAAGGGTCCGCCTTTCTCGCTGGTGCGGAAGTGACATACTTAAGTCGGGCCTCGCGGCGGGGCAGCCATCTTGGAACCCAGCACCTTTACACGTGCGGAGGCGATCGTGCCTTAGTCATGTGGCTCAGCAGGTCCTATCAAGCGACGGGGGTGAGGCCTTAGCCTCCAGGAACTTCCGGGCAGTCTGGACTGCCACTTTCCTTTACCTGGGTTTTCTTTACAGGACAAGTTTTATTTATTCTTCCGTTCAGGAAAATATTGTAGCGATATCTCATTGGATAGTAAGTTTCCCCGACTGGAGACAAAAAGGATGGAACCCACTTTTGGGTTAAAGGGCATAGGGGGATAAGCTGTCAAGGATTGTCCCACTCAATCACTGGTTCATTTAGTATGTTTCCAGTTTCTCCTGGGCTTCCTTACATGAATAAGCGAGTCTTAATTCATATTTACTGCCATCTGCTCCCCGGGGATGGCATCTATCGAAAGCTGGACTCTCAAGCCCTGAAATGGGGATCGCTAACAGTGTTAGCTGGAAGAAGACCTGAGATAAAGCACAGCCACTATTTTGAGGCCCCTTAAGGAAGACCACCACTTGCATATCTTCAAAGGATCCTTTATTGACCAGAGCAGGACCGTGGCATTTTTATATATATTTATATATATAAAAAAAAGTTTGAAGATCGGGCAGGCAGTAATCCCTTTGCGCGTCCACCACCCCCACACTGTTTTCCTGCCCTCTGAACATGGAAGGAGGAATGGCTGCTCCACCTAGGCCACAAGGCAACATTCTCCTATAGAGGGAGAAAGAGGCTTGCTTTTATGTGGCCATTCCCTTCCCATCAGAAATCAATATACTCGCAGCAAAAAAAAACAAAATACAGAAACCAAACATTTAAATATGAAAATCCAAAGGGAATTGGGTAGAGAAACAAAAAGGAACTAGAGTTTCTTGGGAAGGGTCTCCCTTTCCCCTGCCCACTGATGGGCTAAGGGTCTGGGGTATGAGGCTCACACAGTGAGTTTGCAGTGACACAGTTCCTTGTAGATCTGACGACGGAGTTTGGGCATGTCCTGCTGGGTGAAGCTGAATGGCTGAGACAGGGCCAGGTGCTTGCAGTACTGGGTGTTAACAAAGTAGACCATGAGAACAGTTTACTGAGCACCCTCCCAAGTCAGGACCTGTGCTACACATTTCACACAAAATACATCTTAATTTCTCAGAAAATATCTGTTTCTCATACACACTGCCATTATAGACTAAGCCTGGGGCTTCAACAAGCCTACATAATATATCTGGTGTTTAAACTGGAAAATATATTTAGTTGGATGTTGGGAAGCCTCTATATCAGGACCAAAGCCAGAGATACAGTCCCAACTGAGGATGGAGAAAACCAATGAAACCAGGGTTTCTGTGCTAACACATAAAAGTACACCCTGCTGTGCAATCTGACTGAACCAAATGAGGCAAGAGCTACCAACAACCCCTAAGCTACTGACTGAGAGCTAAGAAGACCTTATCATTTGCTTACCTGTAATACAAAGGCACCACAGTCACTGTCATTATTCTGCCTGGCCACATTCTAGGGAATAGAAAGCAAGAATCTGTTCACTTGGAGACTCCTAGAGGTTACGAATTCAATTGCTGCCTCCTATCAAACTATTCCATTTTTCTCTGGAAACTCACCATTTTGAAGTAACCTTTCCAGCCCTGATGGAAGTCCAGTCGGTCTTTTTTGACTGCCTCTGCCTGTAGATACTTGGCAATATGCTATGTGGGCAAGAAAAAAGAAAGTGACACCTTAATCACCTGCCAGTGTAACACAGAGTGTGCTGGTGGGAAACATCACACCCACTCACTCCTCGGACTCCAAGCCCACGCTTCTTCCTGAAATGGCTTGCTGCCACATCTCCCTACAATTTTACTACTTGTTTCCCCACAACCTCCTCAAACCTTAGGGCAGCGGCGATTTAGAGTTCGCTGGGAGTCAAAATAGGTGATGGTACGTCGCCTTACATCAACTGAGATAAGGGACCAGTGCACCTCCAGATGGATGGGGATTAGCAGTAATTCCTTATTGAAGATGTCCACCTGGAAAGAGAGTGCTGGAAGTCAGCTACAACATAAAACCCTATTGATTGCCATGAGGATTCTAAAAAAAAAAATATGGAACAAGCAAAGGAGTTACAAAATATACATCATGGACTGTGAGGCAAGGCTCAGCATCAGATGCTATTACTTTTGGGAGGGTTTTTTTTCGGGGGTGGGGTGGGGGTGGGGACATACTCTTCAGACAATGTTGCCCTTTTGTTTAAGACTGGGTCCTTCCCTGACTTAGGACTCAGCAAATAACGTTGGTGGGCTGGCCAGCAAGTCCAAGGAATCTACTTACCTCCACTTCTGTAGCACTGAAAACAACTACCCCTGGCCTGGCTTTTTAGGTGGGGATCAAACTCCAGTCCTTGTATGCCCTCTATAGGTTGAGATATCTTCCTAACCCAGATATGCTCCTGCTTCTCAGGCCTGGCTGATATTGAGATATTTGATGGTGAAGAAAGACAGAAATAAGAAGGTAATATCAGAACACATGTGCCTTCTAATTTAGCACCTGGGAGGTAGAACTACGAGTTCAAGGCCAGCCTCTACTACATGCTCTGCTACCAGGTACATATACATTAAAGGAAAAAGTCTAGATAAGTACCCAGACTCTGGAGCTGCAGAAATGGCCAATTGGTTAAGAGCACTGGCTGTTCTTCCTGAGAAACAGAGTTCAATTCCCAGCACGCATATGGTGGCTCACAACCACCTGTAACTTGAGTTTCAGAGATCTGATGCCCATGTCTGGCCACTATGGCACTGCATTCATGTGGTGCTGAGACATTCACTCAGGCAAAACATATATACACATATAATAATTTAGAACAAACAAAAAACAGACTCAAGATTTTGGTGCCACACTGACATGGTTGAAACTCAGCTTCTACACTTACTAGTCCATGACCATGAGCAAGCTACTTAACCTTCTTTACCTTTCCTTATCTGGAAGAGGGAGAGAACAAAAGCACCTGCCCTCATTCACTATAGGGAGTACACTACTATCCACATAAAACACATGGCCTGAAAGAAATGCTCACACTATCACCAACTTCTTGTGTCACTCAAGACAGGAGGAAACTGCAAATTGGGAAAGTAATTGCTCAAGGTCACAGAAACATTTTTTTATTACATTGTTATTGGGAGGAGGGGAGTGGGTACACATGCCAGGGTGGAGGCATGGAGGTCAGAGGGCAAGCTGATTCTCTCCTTCCTTCCACCATGTGAGTCACACACAGGCTTGGCGGCACGCACCTTTTCATTTACCTCAATATACAGAAGGCTAAGTAAGGGTTTTTTGTTTTTGTTTGTTTTTAAACTGTATTTCACTCTTGCTTCTACTGGAAGAAACACGACTCAACAGGTCTCTGAGTAATTCTAAGCACAAAAATTAAATCCTGATGCTTGGACTGGGGTTGTGAGTGACAAAGAGCTCTAGCTCTAGCTACTATCTGGGGTAGGTCAGGGAATAGAAAGGCAGTGTTAGGTAACAGGAGGAAGACATGTGTGTGTTAGAACCAATGTTCCTTTGTCCTGTTATGAAAGGCCATGAAATTTCAGGACAGAGAAACCTATGGAAGTTCTTAAATACCTCCACATCTGCTCCTGACCCAATTTTTACTATCACTTAAGCCAAAAACCCAGATATAATTCTCCACTGATCTCTTCATCCCACATGAAACCTGCCAGAAATGTCTACAAGTTCTACCTTAACCTCCTCTCGCCTCTCCTTTTGGCACTCCAGCCCCAGGTACTTCACCTAGACTCCTTTCTCCTTCTATTCCATCACCGAATGGGGACACCAAACATGAAGCATCGCTAGTCTGGTAGGGTAAAGGTGTTTCCACCAAGCCTGACTTCCTGAGTTTGGGCTCTGGAACCCACATCACAGAAAGAAAGAACTGACTCTTACAAGCTGACTTCTAACCTCCACATCCACACCATGGCATGCACTTACATCCACACAAGACAATGTACACAGAACAACCTCTATCCTTGACAGTCTACCTTACGTGCCTCACATGATCTTCTCCAATTTTCTGTATTCAGCTACCACAGTCACTGTGTCAGAGTGGTCTCTTTCTCTGGGTCTGAAGCACTTGCTGCTCCTTTTGCCCAAGTGCTGCTCCCAGACCGCACAGGATGACTCCTATCACTCAAATGTGGAAGGCCTTAGCACAGATGTAAGGAAGACCTACACCCAATCCAAAGTCCCCATTCCCATGCTGTCACATTACTGTTGTAGGACATTTGCAGCACTCCAGGACCTGCTGTAATTTACCCTCATTCCATCACAGAAAGAACTCTTCTGATTTAATACTGCATCCTCAGTTTCTACAATCACGCCTGATACACAAGACCTTTAACCTTTGTAGAATGATGACCAGGATTGGGGAAAGGACTCATAGCAAGCAAAACTCTTATTACATTTTTTTTTAGAGACAAGGTGCTATATAAGTAGTTGTAAATTCGTAACTCACATTTTTGGTCCACCTCTTTACCCCATCATAACCCTTGGTACGGAGTTTATCATAGAAGAAGCTGTTGAAGAAATGCACCTGTGCCAAAGACACAAAGAAGCTGAACAGAATGAAAGACTTCAGCTTGCCCACAATTCCACCCTCCCAATCCACACACTGCTTCATAGTGTCCAACTGAAATGGCTCCAAGGATACCACCATACTCTTTTTAACCTTTTATAGATAAGTTCCTGTCCCAATTTAACCAAACAGGAAAACACTACAGATTGGCTTACAGATTTAAAATGAATAGATTAGCCCTTACTATCTCCCCCTCCAAACCGCAGACCTTAGGCTATATAAAATAGAAGAGATGAAAATGGATGTTTACCAAAAAATAAAAAGTAAAAATAAAAAGGAAAGGAAAAGGGAGGAGAAAACTGCTCAGAGTGCTGCAGAGATGGCTCAGTGGTTACCAACACTGACTGCTCTTCCAGAGGTCATGAGTTTTAATTCCAATCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCAGATGCCCCCTTCTCGTGTCTGAAGACAGCTACAGTGTACTCATATACATAAAATACTTTAAAAAAAAAAAACTGCTCAGGATTGCAAAGGTTCTGGTGACTAAAGAATCTGGTTAGTGTTGGGTCAGGAAAACTAGGGCTACACAGAAAAATCCTGCCAAAGGGGGGGGGGGGGGCGCGCAGTGGTGGCACACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGAATTTCTGAGTTCCAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGCCTCGAAAAAAAACAAAACAAAAAAGTGTGCTTGGACCTACCTTTTCAGGGACTGTGTCCATGACCAGATCTCCATACATGTTCATCACCTGTGGAAAAAATGGCAATTTGCTCTGGAGGATGTAGCATGGGGGTGGAGGGTTCCCTTACGCATCCACTCTCCCTCCAAAGGCCTTTTCAAGCTCTTTTATGTTCCTCTTCTTACCTGGTCATTGAGCCAGTTCTGTCCATATAAGGTACCCAAGTCATCCATGGTGAGCACGTGTCGCTTATAGGATACCCGGAAGCCCCTTACCATAGCGTTGCCTGGCATCCGCTGATAAGACTGGATCAGCTGTAGTACCAGACTCTTCCTGCATAGGCCAAATTTTTGTAATTATACAAGAGCTAATGTGGCTGGAGCAGCCAGAAATACCCACTACTACTGTCTAGAATAACTATGTAAAACAACTTTTCTTTTTCACAGGTTGTTTCGATGGTCTCCCACTCCCCACAAAGAGACACGAGAATGCTCATGGACAAGCTTTTCAATGTCTCTTAGTGTCCTACATAAAGATCCCCCCAGTTGTCTTACAGGGCTTGACACTTTGTCTGCAGCTTCCTCAGCTGCAGCTCTAGCTCTTACTTCCTCAAATCCACCACATTCTCTCCTCTACCTAAGGTAGGTCTCAGCCCTCCCTCAGTGCTCACCTTGAGGGTGTAGAGAACTCCTGCTGGAAAATGTCCTCCAACTTCTCTACAACTTCATCAGTGCTGAGAGGGATGAGGCTGCCATAAGTTTGAAGGAATTCATCTAAGATACCTAATGGAGGTAGGAGAGAGTAAGCGGGGGCCTTTAGACTCTATCGGAAAAGCTGGCCAGAAGGGGACTAAGTCTTCTGAAGACTCACTCTGCACACAGGTCACATGTTCCTCCCGAAGGGGGCTATGCTGGCCAGCTTTCTCCCCAGTCCGATCTGCCTCTTCTGCAATGCCCAAGTCAGAGCTCTGAAAAAGTTCCTGAGCCACGTGGTCTCCAATGCTGCACACATTACTGATGAGTATGCTGGCATCAGGGGGTGCCAGGCTGCGCTCCCCTTCAGGACCAGACAGTCCCCCAAAACCATTGGGTAGAGTACATGAGAGGAGGCCTATAAAGCACAGAAATAGGAATGAGAAACTGGCCGTGTAAAAGAACCAATGCATACAAATGATAAGACCACAGAACACAGACTGAAGCAGAGTCTAGCAATGGAAACCTTATGGAATACAGACACCACCACCCTACACACACACACACACACACACACACACACACACACACACACACATATGTGCGCGCCTAATGTAAGGACAGCCAGAGTTTATTAAAAAAAAAAAAAAAAAGAAGAAGAAGAAGAAAAAGTAGTAGGTCATCTTCAAAAAAGAGGAAGAATGCAAAAGCCTAGGATTTGGAGACCAGAAATCTCTGCTGCCAATATCTGCTTACCACCTAACAGTGCACAGTGAGTGAGGAAGGCTCAGTAGTAGTAAGGTTGGTAAGTTTTTAGCTTGAGTTCTCAAAGAGGAAATATTCTAAATAAAAATGTTAAAATCTACAAATGATATATTCCATAAGAACCATGAGTGTCCTATGGAGATCCACATGTCTAGGCCTTTTTCCGGCAGGAAGAAAGCCTTAGAATGGACAACATGATTTCCTAGAGCATAGATAGCTCTTTGTCATCTGCACTGAAGACCATAGGACATCTACTTATGTAGATGTTCCCAACACTGTGTCCCAGGTATCAGTCCTGCTAAAAATCAGAGTCCCCAGCTCCCACAAGATAGGATCTTTCTTTGCAGCCCAGGTGGGGCCTTGATTAATTGTTCCATCTTAGCCTCCAAAATCATAGGATTAGTGTGTGCCTAGACGGGCCTTTAAAATTAAGGCTTAAATCGGGTGGTGGCGGCGCACGCCTTTAGTCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAATGAGTTCCAGGACAGCCAGGACTACACAGAGAAACCCTGTCTCAAAAAAAAAACTAAATTAATTAATTAATTAATTAATAAAAATTAAGGCTTAAGATCATTTCACGGATATTCTGGAAGCTTTGCTCTGCTTTTCTTAGGCTCACCATGGCAACAAACTCCTGGTGCTCCAGGCTCATCACCCTTCCCATTTCCCACCTTACCCGAGTCAGGGTCCAGAGGAGACTTTGGGGTCCACCTTAGTCCATCTTCCTCCATGGGGGGCCCAGAGGGCACTGGTGGAGACCCTCTCATCCCATCCTCTGCCATGAGAGCACCTAGCAGACCCAGCCGGGGTGGGGGTAGCCCCCGGGGGGAGTCAAAACGACAGCAGGGTGATGGCACCTGTGGCGTTGCACCCCCTTCCTGGGGTGAGAGATGGTTCTTGGGGTGCGCGAGGTTCCGCCGCCGGCCTCGGTGGCGCCCCCAAAGCTTCCAGTGGAATGTCAGCGAGGTGCTTTTTGAGTAGAGCAGCATCTGGAAGGCTCTCATGGCTCGGCGCCGGCGCTGTGAGCAGGTTTTTCTATGAGAGGGTCGGAGAGCTCGAGAGCGCTGGGAGGCCCCCAGTTGGCCCCACCTAGGGGGTAGCCTCCAAGCTGCTACTTCCTCCTCATCTTCCTCCTCTTCCTCTTCCTCTTCTTCACTAGCTGAGGCATCAAAAGATGGCCGGGGGGCAGGGAGGCGTCTAGTTGGCACTGTGGTCCCAGACCCAGGATCTGGCCCAAAACCACCACCGGACTTGAGCCGGGGCTTAGGGGGTAGGGGCCAACGAAGACGCTCTCGCCTGGGATTTGAGTAAGTGGTGCCGGGTCCCGGAGGCTCAGGCCCCCAAGACCCGGTCCCCTGTATAGTCTCTTTCATCTTTCAGTACCCTGTAAAACAAAAGTTTGATTATCCAACTGAGGACACCCTACTCCTTTCTCCAAGATCGGAACTGTTCTTCAGCATTGTCCCTCTAATCTCAGATACAGCTAAAGACAAATCTAAAAACTCATAACTTCAGCTCTTCCCAG
D3_15 69463139 69478188 15050 GTGTGCCACCACGCCCGGCAAGAGTTTTAATTTTATTTCCTTAGTGATAACAACAAAAATTAAAAGCCTAATTCCTTCTTTATCCATTTAGGCAAAGTGATCGGAAAGAACGGGAAAGTGATTCAGGAGATTGTGGATAAGTCTGGTGTGGTGAGGGTTCGTGTGGAAGGAGATAACGACAAGAAGAACCCCAGGGAGGAGGTACTGTTTTCTGGGGTCTGGTGACTTGTGGAGGGCAGAACACAGAACCTTTTGTTTGCCCTAGTATACTATGATCCTGTCAGTCTGAGAGGTGGGCTTAACATTTCAGTCTTTTTGTTTTGTTTTGTTTGAGACAGGGTTTCTCTGTGTAGCCCGGGCTGTCCTGGACCTCACTTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGCCACCACGCCTGGCAATCTTTTTCTTTTTTCTTTTCTTTTCTTTTTTTTGAACAGTAGCTCACTCTATAACCCTGACTTGCCTGGAACTTACTTTGTGAATCAGGCTAGCTTTAAACTCAATTCACAGAGATGTGCCTGCCTCTGCCCTTCTCAGTTTTGGGACTAAAAGTGTGTGCAGCGGTGCCTGGCTTTTTTTTGTGGGAATGGGGAGGGTGGCGGTTTCGAGGCAGAATCTCTGTGGCTTAGGTCATGCTAGCGCTTTGCTGAGAAGCTGAGGATGGCTTTGTGCTGTTCTTGCCTCTGTCTCCTTGGTGCTAAGATCATGTGTGCCATCACGCCTGACTTGTAATTTTCCTGTTGGTCTTTTCTCCAGGGAATGGTTCCCTTCATATTTGTTGGCACCCGAGAGAACATCAGCAATGCCCAGGCACTGCTTGAGTATCACCTCTCCTACCTGCAGGTACCCATATCAGAAGCCTGGGGCAGGGACAGGCGGGGTGGCAAGGAGGGCATGGACCTCTAGGACGTAATCTTTGGGACTATTGTGCCTGGTTTGTTTGTAGAACAGGACCATTGGTGGATATTTTGGCTCTGAGACTGTATCCCGAAATGTTCTTTTTAAGCCTTTGTCTTCCTAAGCCTAAGTCTTGAGAGCTCAGCAGCGTAGGACCATGTGACATGGGTGGGGACGCTTGGAGGAAGGGGACTGACTACTCTCTTAATTCTCCTGTGTTTCTTCCATCTTTCCAACCAGGAGGTTGAACAGCTTCGCCTGGAGAGACTGCAGATTGACGAACAGCTTCGGCAGATTGGGCTGGGCTTTCGCCCTCCTGGGAGTGGACGGGGTGGCAGTGGTGGTGGCAGTGACAAGGCGGGCTATACCACAGACGAAAGCTCCTCCTCTTCCCTGCACACGACCAGAACCTATGGGGGCAGCTATGGGGGCCGGGGCCGGGGCCGGAGGACTGGTGGTCCTGCCTATGGTGAGACAGCTGTGTGGGCAGTGGAGGAGGTGGGTGGAAACTTAGGAAAGCAGTGACTGACCTGGGTCCTGTGAGTGGTAGGAAGAGGAATTCTAATTTAGATGTGGTGGTTGAACTCCTAGGACAAGCACTATTGTCTCTGAATAAACCCTTCTGTGTTCTTTAGGCCCCAGCTCAGACCCCTCCACAGCTTCAGAGACAGAGTCAGAAAAGAGAGAGGAGTCTAATCGAGCAGGACCTGGTGACAGAGATCCCCCAAGCCGTGGAGAAGAAAGCAGGAGGCGGCCGATTGGGGGCCGGGGAAGGGGACCCCCACCTGTTCCCCGGCCTACCTCAAGATATAACTCATCATCTATTAGCTCAGGTATCAGAGCTGGGGTCATGGATGGTGACCTGAAGGAGAAGACAGTGGCCACCTGACTCCCCAGCCTCTTCCTTTTGTTTCACTAGTGCTAAAGGATCCAGACAGCAATCCTTACAGCCTCTTGGACACATCTGAACCAGAGCCTCCAGTTGATTCGGAGCCTGGTGAACCTCCTCCAGCAAGTGCCCGTCGTCGCCGTTCCCGCCGCCGCCGTACTGATGAAGACAGGACTGTCATGGACGGAGGCCTGGAGTCTGATGGTCCTAACATGACAGAGAATGGCCTGGGTGAGGGGCTAGCCTGGAGAATTCTTAGAGGTGTGATTAAGAATGAAGTATGGCCGGGCGTGGTGTTGCACGCCTTTATTCCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTTTGAGTTCGAGGCCAGCCTGGTCTACAGAGCAAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTGGAAAAACCAAAAAAAAAAAAAAAATGAAGTATGAGAGGGTGGGTGAATGACTCTTCTTTACTCCACAGAAGATGAATCAAGACCCCAGAGACGAAATCGCAGCCGCCGCCGCCGTAATCGTGGTAACCGGACTGATGGGTCCATCAGTGGAGACCGCCAACCAGGTCAGCTGACATACAGAATTGGAGCCTTTCTGGAACTAAGATGAAATGTCTCATTGGCTGGGAAACCAGGGTTGGATTCATTGGGAACCATGAAATCCCGAAGTTCCTGAAAGTCTTGATCCTGTGTCTTTCCTAGTGACTGTGGCTGACTATATCTCACGGGCAGAGTCTCAGAGCCGCCAGCGGCCCCTGGAACGCACGAAACCCTCAGAGGATTCTCTTTCAGGACAGAAGGTAGGCAATCAAGATACAGCCTACCCCACTTTGTTGTTGTTGTTTGTTTGTTTGTTTGGGGCAGGGACACAGAAAACTTTGCAAAGAAAGTTGAATTGACTGTATGTGATGGAGTTCAGGCTAAGCTGAGGGTAGAGCAGAGCCGGCACAAACAGAAGACAGGGCTGGTGGTGATTGAGCACAGGGGGGTGAGGGACCTGGCCTCCACGTGTGTCTGTAGTGAGAAGGAAGGCGTGCCTGCATCTGCTGTACTCATCAGCTGCTTCCTTTTTGTTTTCCTCCTGCTTCCTCTGTAGGGTGACTCTGTCAGCAAGCTTCCCAAGGGCCCCTCAGAGAATGGGGAGCTCTCTGCCCCCTTGGAGTTGGGTAGTTTGGTGAATGGAGTTTCATAAAACCTCCGGTCCACATCCCTCCTTTCTCCATCTCGCTTGCTGCCCACCACCATGGCCCTCATGGGTCCAACTGACCTGCGCTGGAGCTGCTCTTATCTACGGGGGAGGGGGGTGGCACAGCAGCTTGGGTCCCCCCCAACCTCCAGGAGCTAGTGGAGGGGTGTGTAACAGGGTCATACCCCTCCCTCTTGTCCACCCTACCCCCAGGGTGAGGGAGCCTCCCCTTCCCTTTCAGACTGGATGTGCCTTTATCCTCTAATGCCCCGACCTCTGAACACCCCCATTCTCCGCCTGTTGGTGGGGGTGCTCCTTGACCCACCCAGATTTGACAGTTCAGGGGGGCTCCCCTGCTATCCCTCCTCCCATCCTGTACCCCCCATTTCTGGGGCCTCATCACTGTGGAAGACGGGGATAGTGAGGGTATTCGTGGGTGGGAGGCATGGGGAAGGTTTTGGAATAGAACCAGGGGTATGTATGAAGGGGGGTGACAAGGTCTCCCAGGGGAGTTGGGAGGAAATAACCTTGTCTGGTGGATGAGAAGGCGTATTTATTTTTCACTGTACAGTATTTAAAAAGAGAATAAAAAAATCCAAATGGCCTTGTGTTTCCCATGTTGCCTTTGTCCCCAGTCTGGGCTGTTTAAATCTCTAGGGCTGACCGGCATTGGTCCCTGGCTCTCGTTCTATAGCCTTTATTATCAGCTCCTCGTTCTGTGTCAGGAAGATGATATTCTGGGAATGGCTGCATCCTTAATTCTCCGTGGCCAGAGGACCGTGCTTCAGACCTTGCTGTTTCTTCCCTCCCTTGGTTGTTGAGAGTTGGGCCACTCCTGAGCCCTGAGTCACAGGAGGATAGGCCAGGCTCCGTGAAGCTGGAGCTGTTCCTGGTAGAAGCTGAGAGTCTGAGCAGGCTGTTTAATCCGATTATCTGGGGCCTGGGGCACAGGCTGGGCCTTCAGCAGAGAGGAAAATAGGGTTTCCTCACCATAGCCTCTAGAACTCAGGAGGGCAGGTTGTATTTCTGGCCTGGTGTCACTCTAGCTCTAGAATCCATGTCACTGACCTCAGCTTTTAGGGGCCTCAAGGGTAAAGAGTAGTGACTATCGGAATTGGGAAGCGCCAGAGCTAGGTACAGTGCACTGCACTGTGGTGAACTGAACGTGATCCTCAGGAGGGTGTGCTGAATGCTTTCTCCCAGAAACCTTAGAATGGAGGAAATCGGGATTCTTAACTATGTAACTGCTGGGCAGTACTGGGCACACGCCTTTAATCCCAGAACTCTAGTCCGAGATAGAGGCAGGTGGATCGAGTGAGTTCAAGGGCAAGACAGGATTATTAGACTAAAGAAAGAAAGAAAAAAAAAATTCCGGTACCCAGGAGGCAGAGGTAGATGGATCTTGATCAAGTCCAGCCTAGTCTACACAAGGAGCAAGGAGTTCAGGCCAATCAGGGCTATATGCTGCACTCCCTGTCTCAAATAATTACACTTTAAAAAAAAAAGAAAAAAGGGATCAAAGGGGTAAAGAAACAGCTCAGCACTTAGGTAGATTTCTGAGTTCAAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACAAAAAAAAAAAAAAAACAAAAACCATAGCTCAGAAGGTTAGGTGCCCCCTGAGATCAGTCACGGAGATAGCCACTACCACCTCTCCACCTTGACCTGGGAAAGAGAACGGACTTGTGAAAGTTATCCTCTGACCTCTATATACAAAGTGGTGACACTTGTGCCCCACCCCATCCATAACCTTTTAAAAAATAGGAAGATTTTTAAAAAGTGTATCTGCAGGCCCAGAGGCATGTCCATGGTTTGGGCTTAAAGATGAAACTTGCAATACTCAGTGGCAATGGGGAACCTCAGGACTGGAAGTGGCTTTGAATGTTTTCATCTGCCTAGCACCTGCTGGAATGACTAAGAAAACAAAAATGGCCTTGAGTTTCTTTCCCCTGGGGCAGATCAGGGGTTTAAGGAGCAACAGACACCGGAAAAGGCTTTGATAGGGAGTGAGAGCTTCTTAAATTCTCCGGGTTTGATCGACCCTGGGAGCCTTTGGTTCCCCTTCTTGGGAAGGAAGTTACTTTAAATTGCTGGTGCTTGAGAATTGAGACAATTTTTAGGCCTGCCGTCCAGGCCTCCGGTGGAACGTTAGGGGGGTGTGGTGCCCTAGGGGGAGGTGTAAGGACTGGGAAGAACAAGACGCCTGGGTTTGCAGAAAGAAGAGGGGTGGAGAGAACCGCACAGCCACTGGGAGGGGTCTGGGGAGGAGTCAGCCTTTTAGAGGCTGAGTACAGGTGGGAAAGGCCTGTAGCACCTGGGTGCACTCCTGGCAGCTGTTGGGACTTTGTGGAGACCAAGAGCTGCACGCTTGAAACTGCAGTTTCAACAGAAGAACCCTGTCTCGCTGAAGCAGAGGGTAGAAAGAGCGACTGGTAGACCTGAGAGAACACTACCTCTCCGGTAAAGGGCTCCAGACAAGGATTCTAAATTCAGCTTCCCAGAGGTGACAATCGATCGCTGGGAGCAAAGTTTGGATTCAAGCGCTCTGGAAGATACTTAAGTACCCAAATATTCCTAGTCCAGTCTTCGCTCTGGGAGAAGGGCATTCAAGACGCCCTCTCAAAGAGGCTTCACCTCCAACCCATGGCGCTGACCAGCTCCTCACAAGCAGAGACTTGGAGCCTGCATCCTCGGGCTTCCACGGCCTCTTTGCCTTTAGGACCCCAGGAGCAGGAGGCCGGCGGGAGCCCTGGAGCGTCTGGGGGACTTCCGCTGGAGAAGGTGAAGCGGCCCATGAACGCCTTCATGGTGTGGAGCTCTGTTCAGCGCCGCCAGATGGCGCAGCAGAACCCCAAGATGCACAACTCTGAGATCTCCAAGCGCTTGGGCGCTCAGTGGAAGCTGCTGGGCGATGAAGAGAAGCGACCCTTCGTGGAGGAGGCTAAGCGTCTTCGTGCCCGCCACCTCCGCGACTATCCCGACTACAAGTACCGACCCCGGCGTAAGAGCAAAAACTCGAGCACCGGGTCTGTCCCCTTTAGCCAAGAAGGAGGTGGCCTGGCATGTGGTGGCTCACACTGGGGGCCAGGGTACACAACTACCCAAGGGAGCAGAGGCTTTGGGTACCAGCCCCCCAACTATTCGACAGCCTACCTGCCTGGCAGTTACACGTGAGTGCCTAATTGTGTCCATCTGTCTGTTCCATGCTTCCCACACGACCCCCTTCCTTGAGAGCTGGGTGGGAACAGAGGCCAGAGTGCCAAGTTAAACCCAAATCCACCCAAGCAGAAGCTACACCAGGCTGAGGGCCCAGAGTTCAGGATAGTGGCTGTTCCATCTCAACTAATGTGTCCTACCTCTGCCTTTTGGATGGCAGTTTCTCCTTGTGGCTGGCCCTTGTGTGACCCATCTTCCTCTCCCAGCCCTGGGGGCAAGGAGAGACCAAGCCCATCCTGTTGCTCCTTCCTGGCCTGCTGCCCCAGGAGGCAAACAGCCGTGCAGCACGCAAGCCGCCTGCTGAGCATGCCCCAACAGAACTACCTTGTTCTTTAAGTCACCCTAGGGTCCCATTCCATGCCTGCTGTACCCAGCAAGGCTGGCTGAATGGCAAGCTCTAACCCTGTCTGCTGCAAACTGGTCAGACCAGTCCCCCACGAAGAGTTGAGGACACTGCCCAATCGATTCAAGAAGACTAACCTCCAGACCCCATGTTTCTTTTTACAGCTCTTCCCACTGCAGACCGGAGGCCCCCTTACCATGCACCTTCCCTCAGAGTGATCCCAGGCTCCAGGGGGAGCTAAGACCCTCTTTCTCCCCTTACCTATCCCCAGACTCTTCCACTCCATATAATACTTCCCTTGCTGGAGCCCCCATGCCAGTAACCCACCTTTAACTGGCAGGGACGCCCAGGGCCAACCCCACAGACCCCTACAGATCTCCAAGGAACCAGAATGCACACTAAACACAATTTTGTACAATTAAAACCATGTTTCGGAGTCTTTTATTGTCCCATTTGTATTCTCTCCCTACAGCAGCAACCAGCGCCTTCACACACCCTTCCGCCAGGACCTGCCTCGGCAGGAACCTCCCCACCCAACCCCAGGGCCCTTATCTGAGTCACTCTCCCTCACCCCCAGAACTGGGCTCCAATAGACCATCCCACCCGGGCAGCACAGGGAAGCAGCCACTAGCTTCCAACCACAGTTTTCTAGGCTCTGTCCTTGGTCCAAAAGGAAGGTAAGTGGACAGGGCCAGAGCATCTGCTCCAGTAAACCAGCTGCTCACAAGGAGGGATCTGGGGAAGTGAGTGAGTGAAGGCAGGGCCTACACAAGCTTTACTGCTCCCACAACCCTGGCTCAGGAGGCTGCAGTTAGAGGAATGGAGGGTGCTTACACTGCACCCGCAGATCAAGTCATGTGGGGAGGACTCTGAGGATGAGTGGAAATGGAATTGTTCTAGAAGCGAGCTCAGCTCTATTGCTCCTTTTTCTGTTTGTGGGGAGCCTTTGCGTTCCAGTAGAAGAGGACCTGGGCAGCAATGAGGCCATTGCAGAGAGAAGAGACCACAAAGACTCCAGCCATGAGGGGGTCTCCAGTTTCCTGTTATGAGAGAGCACAGATCTAGAAAAGTTCCAAGACTCAGCAGAGAATGAGGTTTTAGTGCCCTCTAGTGGGCAGAAGGTGCACTCACCTGAACAGAAGTGAAGATTCGGGCCAAGGAGCCCCCAAACAGCATAAACACTGTAATGGCTGAAAGCTGGCCTGTGTGTCCGTTGCGGTAGTTAGTGGCTGCCTGAAGCAACTAGAGGAGACATTGATACTTTTGGTTCTCTCATCTGACCCTTCTCCGTGACCCGTCACTATTCCTCACGCCCTGCACACTAGCACTCCATAGTTGGAGGTCCTCCTCTGCCTTACACTAGCTCGCGCGCGTACACACACACACACACACACACTCTCACGTCCCTTTGCTTCCTACTTCCCCAGAGTACCCACCTTCCCCACCACCACGGCAGGTACATTGGAGGCCTGGAGCAGAGTGACTACAGCCAGAGGCGTGAGCGGGGAGAGCAGCGCCAGCAGGACCATGGCATAGCAGGCAAGGAAAGCGACTCCTGGGGGTCAGGGAGACAAGGAGTCCTCTTGAGCCTGAGTCCCCACCAAAGTTCCCATACACAATGCCTGCTCTCCAGCCAGTCCCCGGCACCTTTCACGGTCTCTCCTCTGTAGTGCATGACCAGGAAGCAGATGGCAACGGTCTGGAGTGTCAGGAACAGCGCTTCACCCCAAGAGCTGCAGAGTCAAGGGGTGGGAGGAAAAAGGCAGGCCTGGAAAAAGGCAGGGGAAGCCTCCATGCCCCGTCCGGCTCAGCTCTGGGATGAGCCTGTGCTTTTCAGTCTGCCACTCCCACCATGCCTGGCTCACGCAGGGAAGGCTCGCTCCATCCCCATATTTACTTATTAGAACTGCAGGTGCTGGGGCCAGAATAGCTCAGCAAGTAAGGATGTTTGCCTCTGAGTCTGATTGCCTACGTTCCAGCCCCAGGATCCACACACTGCAAGGAGAGAACCAACTCCTACAAGTTGTTCCGTGACCCCTCCCACCTCAAATAAACAAACTGAAAAGAAAAGAATTGTGGGGCTGGGCGGTGGTGGCACATGCCTTTAATCCCAGCAGTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACGGCCAGGGCCACACAGAGAAACCCTGTCTTGAAAAACCCAAAGAGAATCTTGGGGATTTGGCTTTGGGCGTGAAGAGTGGACCCTCACTCACCTGAAGGGGAAGTTGTTGGTGATGCTGTAGACCACGGTTCCGGTCAGTGCCACTAGCTCCAGCATTACTGACTGGAGACTCAGTCCTTCTGCACTCTTGGCTCCCAAGAGTTTAAATACCTGGGGCAGCTTGACTGTGGACAAAGCAGCAGGGCTGAGGAAAGGGCACTCTATCCCCAGCCTTGGCATCCTCAGCCTCTCACCTCCCTTCCCTTTACTCCAACAGCAGGAAGGAGCTGTACGTACCGAGAAGTGACCCAGCCACGATGCCCAGCCCGAGGCCTTTGCTGAGGAGAATCTTGAGGCAGGGAACTGAGAAGAGAGAGCAGTCAGCAGAGAGGCCTCTGGCGCCCAGGTGAGGGTTTGAAGTGCTCCTAGGAGCTGTTGCCCTCTCCCTCACCCGTGACCACCACACCTACCACACCAGTAAGTCTCTGGGGGTGGTAGGGATGACAGGGCAAACATCCTTGCTACAGACATCTTCTATTCAGACTGGGTGTGCTGTCACAACAGCTTCTTCCTTCCTGTCCCCCTTCCATTCCCTATAAATACACGTCTAAAATAGTTTTGAGGGCTGCAAAGAGTAGGGTTGTCCCCTTCAGAAGGACCAGGATAACCAGAAGGTTCTGAAATGTATGGTGTGGGCACTTGTCTTTGGAAGGAGGAGCATTTGAAGTAGGCCATCCAGTTCCTGAGGAGAGTAGGGTCAGGGAATTCTTAAGCAATGCCTGTGTAACTAAAAAGCTAACTTTTATCCCTCATTAACCCAGGAGCCACGTGGTAGACGGACAGAAACAACTCCAGAACTTCCATGCATGGCCCCCCTAATAAACTGTACTAACAAAAATGCACTAAGGCCGGGCGTGGTGACGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCTCTGAGTTCTCGAGGTCAGCCTGGTTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAACCCTGTCAAAAAAAAAAAAAAAGCACTAAGAAAGTATGTCTTTTAAAAATGGAGAGATGGCTCAGAGGTTAAGAGCACCAACTGCTCTTCCAAAGGTCATGAGTTCAAATCCTAGCAACCACATGATGGCTCACAACCATCTTTAATGAGATCTGATGTCCTCTTCTGGGATGTCTGAAGACTGCTACAATGTATTTACACATAATAAATTAATTAAAAATGAAATCTTTTTTTGTTTTTGTTTCTGTTTTTTTTTTTTGTTTTTCGAGACAGGGTTTCTCTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGCCACCACGCCTGGCTGAAAAAAAATTTAAAAAGTCATAAGGGATGTGTGTTGTAGTTCAGGCTTTTAGTCTTATTTAATCATCTCTGAGTTCAAAGCCAGCCAGAATTACACAGTGAGACCCTATCTCAAATACTTAAAAACTATTGTCAGGTGTGGTGGCAAAAACATTTAATCTTAGCACTTGGGATCGAAGGACAGCTATGTGAGTTCAAAGCCAGCCTGGTCTACATAGTGAGTTCAGGCCAGCCAGGGTGATATAGAGAAACTATTAAAAAGGCTGGAGATATGGCTCAGTGTTTACGAGTACTGACTGTTCTTCCAGAGGACCTGGGTTTAATTCCTGACACCCACATGGAGTTCACAACTCTTAACTCTATTTCGAGGAGATCTGACACCCTCATTCATACATACATTCAGGCAAAACACCAGTGTACATAAAACAAAAATAAATCTTTAAAGAAATCATTAGGCCAACAAGATGGCTCTGCTGCCAACTCTGTTGACCTGAGTGTATATAAGGGAATACCACAACAGAAATACATTTTAAACATTTGGGACTGGAAAGATGACTTAGTGGTTAAGAGCACATCTCTGCTCTTGCAGAGAAGATCTGAATTCAATTTTTAGCATCCTTCTCCAGTGACTCACAAATGCCCGTAGCTCCAGCTCCAGTGGCATCTTCAGGCCCTTGCAGTCATGTATAGTATACATATACACACACATATACAAGTGAAAAGACACACATAAAAAAAAAAAATCTACATTTCAAAACAACCCTGGCTGGCGAGATGGCTTAGTGGGTAAGAGAGCTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCCATAATGAGATCTGACGCCCTCTTTTGGTGTGTCTGAAGTCAGCTACGGTGTACTTATGTATAATAATAAATAAATATTAAAAAATAAATAAAAAATAAAACAACCCTATTTTGTGTGTGAGCACATAGGTGCATGTGTTCAGGTCAGAGACTTTGAGGAGCCAGTTCTCCCTTTTTGCCTTTCTGTGGGTTCCGGGAATTGTACCCAGGTTGCCAGCCTTGCAAGCCACCCCTCCAGTCCCACAGGCGTTCCCTGACTCTTTTCTCTCCCCCCCCACCCCATTCCCACATTCATACATTCCTGAACCTTCAGGTTGTCCCCACTCTTCCAGGACATTTATCCTTGTTCTTCCACTATCTCTATCATTTACTTCTTTTTTTTAAAGATTTATTTATTTATTTACTTTATGTGTGTGAGTACATTGTAGCTATCTATCTTCAGACACACCAGAAGAGGGCATTGGATCCCATTACAGATGGTTGTAGGCCACCATGTGGTTGCTGGGAATTAAACTCAGAACCTCTGGGAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCTATCATTTACTTCTTATCTTGGTTTTTCCAGACAAGGCTGCTCTGTGTAGCCAGCCCTGGTTGTATTGGAACTCATCCAGTTGCCTAGGCTGTCCTTGAACTCCCGCCTCTGGGTCCCTCCCAAGGGCTGGGATTAAAGGTGTGGGCCACAGTTCCTGGCAATTTCTCTAATTTTTTTTAAAAAACATTTTTCTTTCAAACCCTGTGTCCAGGGCTGATTTTCAATAGATTGCAGCGAGTGAGCTGAGCTGCTGCCTACAAAACCCTGATCCTGGCAATCTCTCTACCACTGAATCTTTGACCTGGTGGGCATTTGGCCCAGGAAGGCGTCTTGACTATTGTAAGCCAAAAGTCACTTAGAATAGAGAGATGGAGAAGGCTTATCAAAGGCCTTTGTAAAGAAAAAGGAAAGGAAAAGTGCTATACTCCCAACACTCTAGTGACTGAGGCAGGAGGACTGTTGCCAGTTCAAGGGCAGTCTGTGCCACATAGTAAATTCCAGAAGCTGGTGCTGGAGAGAGGGGATAAAAAAAAAAATTTGTGAGCCTCTGTCAGTTGAGTGCTTGGGGCGAAAGGAGGCCTACATGCCTGGCTGGGGTTTTAATTTTGTTTTATAAAATACGAGTTTTCCGCCGAGGATTGGTGGCACACACCTTTAATCCCAGCATTTGGGAGACAGAGTCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGCGAGTTCCAGGTCAGCCAGAGCTATACCCTGTCGGGGGGGGGGGGGGGGGTACGACAAAAAAGCTCCGAGTTTTCCAGCCTGGGGCTAGAGCCTGGTTAGCAGAGTAGCACATGCCGCCCTGAGTTCGACTCCCAGCCCAGAAAGGGATGAGGGTTGGGTACAGACTTCCGAGATTGTAAAACACAAATTTAACTTTTTTTCGGGAGACACCCCTTCATGCCCAAATATGGCACTTTTCCTATGCAGGGCCCCAAACACTTCCGCCCTCGTCAGAACCGCCTTCTGCCCAGCTTCGCGGTGACATTAATCGCCACTGTCACGCCAACTTACGGTTCAAGGCTGCTCCAGCTAGACCTTGAAGGCTGAAATAAAACTCACCATGAAGCAAGTCCCATTGCACGAAGAGCTGGTCGTAACATTTCTCAGGTAAAAGAATTGGCACCAGCAGCCCTTTGAACGGCCCGTCGGCCTCCCCCGCCATGTTGGAAAGCTAAGCTTCCGCCAGGCGGGACAACCCCCGCCATTTATCCGCGCCGCGCATGCGCGCCGCGCACACCCCGCCCTGCTGTCCCCGAGGCCAGGGCTGCTCTTCCCTCTCCGTGATGCTCGCCCGCCTCCTCTAGGGGACACAGGTCTCCTTCCCAGGCAGGCTTTTGTGCGCGCCTTGACGTTCGAATTTTAAAGCGTGTCCGCGTTTGGCGCCTGCGCTGTTAGGACTTCCTCACTTTTGTTTACGCTCTTGTTCTGAAAGCAAGGTCCATGCTGCCCCCTCGCCCTGTCCCCCCTGCATGTACGCCATCTTGTCTAATCTCGGCCAACTTGATAGTGTTTGAAGTTGAAAGGGAAAAGAGTTCGAGTCTTCAAAATGGCGCTAGCAGAAGCACTGCAGCTCTCTTTATCTTTCCTCTTGGTTTCTCCAGAGGGAATAGAGCCGCAAAAGAGCCATTCCGAGCTGGGCCTTCTTTCTGGTCCCCTGCTTCGTCCTCTGTCCAGATGTTAAGAGGATGACGGTGGGGCTGGTGAGATGGCTCAGCGGTTAAGAGCGCCGATTGCTCTTCCAAAGGTACTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAGCCATCCGTAAGGGGCGAGCTCCGCTGCAGGAGAGCAACCCCTGACACAACAGGGGACCTCAGTCTGCTGTGTCTAGGTGGGAACCCAGAGGGTGCGAGCAAAATTCCAGTATTTGTCTGGGAAAGGGCCCCTAGGGTTAGGCGAAGAGAGCCATCTACATTCCACCACACTGCCAGGACACCTACTCTTGGTTCAGGCTGTAGGGCATTCCTAAACTGTTTCTCAGTTCCTTGTTTTTGGGGGTGAGGGGAATGTAGTTGCTGGTCAGGGCATAATGTCACATGTACCTCTGCTGTGTGGGGGCTCTGGTCCAAGAATTTCTGTAACCTCATGGGACTGTTAAATTGGAAAGGCACCCATCCTTGGCTCCCATCCGTTGAACCATGTCCTACTATAAACAGTAGAATTTATACTTTGGTACAGTGGGTGGCTGTCTGAAAAATCCCTTTTTATATCTGGACAAGGGCAGATTGCAATTGCCACCGCTCCCTCTCCTTCTGGTACTCGGGGATGTGTTTGCGAGGCCTGAAGTTGTTCCTCGTAGCACAGCCTCATAGAAGTCGGCTGCACCAGTGGGCTCCTCAGTGAACTAGCCCCGGCCACAGTGCACATGGAATCTCATTGTTCAGTCACCACTTTTGAAATAAATTAATACAGCCACCTACTCATATTTTAGTTGTGTTGTACCTAGCTGCGCCCCGAGGGTCAGCAACAGGGTGTCAGGTCGGAATGATTCATTCTGTAAGGGACTAGGCAGCCATTGGCCCCAGAGGGAGGAGGGAATTTTGGCAGCTTCACCAGCAGTCACAGGACATTGAGGGATGAACCAATGAAGGCATTTGGTCACTCTCTGGTACTTTTGTCCCTTCTTGCCAGCTGTCTCTTGGTGACTCAGCCACGGGAAGGCACAGGAAGGCATATGACAAGAAACTCGTGGCTTTTAGCCCCGGCAGGACAAGGCAAGCCAAGAGAAAAGATTTCATTAAGTGTTTGTACTCTTAATGAGGAAAGAAAGGAGTAGTAGGTACCATTCATGTTTATTGATTCCCCACCCCTATTATAAAATCTCTTCATTGTGTTCCTAAAGACAGAGAAGGAAGGTAACTGTTGAGTCAGTGGCATGGTGAAGAGATGAGGCGCTCCTTGGTGGCTTACACAGTGGACTGGGGCAGATGCTCAGAGGGGCTGGTAGGTTGATTGTCGTCTGCGGGTGATGCAGAAGGCGATGAGCACCAGGGTGAGGAGGCCGAGGAGGACCAGGCCAATGATGAGAGGCAGCAAGAGGGACTGGTCACGGTTGCAAGAGAAACCTGGCAGAATAATGGGATCCCTGAGAATTGCTGCAGTGGTGGACGGGCTAAAGGTGGGAGGTGGGGGAGGACGGAAGAGGAAAGGGGATGAAGAAAGGCTGAGGAGCCAACCCATAGGTGAGAGCAGTCAGCAAAGGGGAAATAAGGCAGTCTTGTAGAGGAGGCGGAGGTCTAGAAAAAGA
GF3 -1 -1 1 CTTCTTCCAGCTAACACTGTTAGCGATC
GF4 -1 -1 1 CAGGTCTTCTTCCAGCTAACACTGTTAGC
EX52 -1 -1 1 GACATTCATGGCGCAGAATTCATC
EX32 -1 -1 1 GATGAATTCTGCGCCATGAATGTC
GR3 -1 -1 1 GTAGACCACGGTTCCGGTCAGTGC
GR4 -1 -1 1 GAGCTGTACGTACCGAGAAGTGAC
Comments:
Created
Target: 2803Ensembl ENSMUSG00000018774 -- 69478253 -- 69479438 ENSMUSE00000329550 -- ENSMUSE00000329533
creating candidate regions
attempting to insert candidate regions into db
done inserting candidate regions
running aos on us and ds
running aos on gaps
finished running aos
AOS Produced 2 oligo candidates from u/d regions
AOS Produced 8 oligo candidates altogether
inserted results of aos runs
Aligned target to NCBIM37 assembly: chr: 11, start 69478253: end 69479438
Found 6 RP24 black6 bacs on NCBIM36
Found enough RP24 bacs: not looking for RP23
Entered all non-repetitive oligos
Sequence count unchanged by blasting
finished aligning oligos to bac
ACCEPT (0) gap pair G5:11:69484938:69485937_517 G3:11:69473753:69474752_172
ACCEPT (0) gap pair G5:11:69484938:69485937_517 G3:11:69473753:69474752_852
ACCEPT (0) gap pair G5:11:69484938:69485937_517 G3:11:69473753:69474752_857
REJECT (1) gap pair G5:11:69484938:69485937_784 G3:11:69473753:69474752_172
ACCEPT (0) gap pair G5:11:69484938:69485937_784 G3:11:69473753:69474752_852
ACCEPT (0) gap pair G5:11:69484938:69485937_784 G3:11:69473753:69474752_857
ACCEPT (0) gap pair G5:11:69484938:69485937_523 G3:11:69473753:69474752_172
ACCEPT (0) gap pair G5:11:69484938:69485937_523 G3:11:69473753:69474752_852
ACCEPT (0) gap pair G5:11:69484938:69485937_523 G3:11:69473753:69474752_857
DESIGN COMPLETE - All Us And Ds ACCEPTED
Creating display features: mapping to reference assembly
Created display features
Inserted short and long range genomic sequence arms

htgt@sanger.ac.uk

Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK  Tel:+44 (0)1223 834244