hccsal

Ensembl ID:
ENSDARG00000095776
ZFIN ID:
ZDB-GENE-090501-4
Human Orthologue:
HCCS
Human Description:
holocytochrome c synthase [Source:HGNC Symbol;Acc:4837]
Mouse Orthologue:
Hccs
Mouse Description:
holocytochrome c synthetase Gene [Source:MGI Symbol;Acc:MGI:106911]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31265 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143057 Nonsense 36 145 1 3
Genomic Location (Zv9):
Chromosome 2 (position 14807760)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15318587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGATGTACCTGCACATCAGGACAGGGCTTGTGAATTTGTGGAGTG[T/A]CCTATGAGAGCTGCCAATGGGACAAAACCCACACTGTCTGACATCAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link