si:ch211-14k8.1

Ensembl ID:
ENSDARG00000095770
ZFIN ID:
ZDB-GENE-091204-55
Human Orthologue:
RTTN
Human Description:
rotatin [Source:HGNC Symbol;Acc:18654]
Mouse Orthologue:
Rttn
Mouse Description:
rotatin Gene [Source:MGI Symbol;Acc:MGI:2179288]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa801 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145978 Nonsense 146 233 4 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 15109137)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 15060585
KASP Assay ID:
554-0706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGATCACCTGGAACACAGCATGGCATTCTGGGATTGATGGATTGCTA[G/T]AGCACCTGAGGGGTTTTAGAAGTGATGTGCCAGAGTAAGTTGGATTCATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link