ENSDARG00000095744

Ensembl ID:
ENSDARG00000095744
Human Orthologues:
CTSL1, CTSL2
Human Descriptions:
cathepsin L1 [Source:HGNC Symbol;Acc:2537]
cathepsin L2 [Source:HGNC Symbol;Acc:2538]
Mouse Orthologues:
4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
Mouse Descriptions:
cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35247 Nonsense Mutation detected in F1 DNA During 2017
sa31870 Nonsense Available for shipment Available now
sa30959 Nonsense Mutation detected in F1 DNA During 2017
sa42000 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142362 Nonsense 172 336 4 7
Genomic Location (Zv9):
Chromosome 12 (position 17942703)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16753877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGGAAAGCTGATTTCTATGAGTGAGCAAAACTTGGTGGACTGTTCC[A/T]GACCACAGGGCAATCAAGGGTGTAACGGAGGCCTCATGGACCAGGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142362 Nonsense 174 336 4 7
Genomic Location (Zv9):
Chromosome 12 (position 17942697)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16753871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCTGATTTCTATGAGTGAGCAAAACTTGGTGGACTGTTCCAGACCA[C/T]AGGGCAATCAAGGGTGTAACGGAGGCCTCATGGACCAGGCCTTTCAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142362 Nonsense 181 336 4 7
ENSDART00000142362 Nonsense 181 336 4 7
Genomic Location (Zv9):
Chromosome 12 (position 17942676)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16753850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAACTTGGTGGACTGTTCCAGACCACAGGGCAATCAAGGGTGTAAC[G/T]GAGGCCTCATGGACCAGGCCTTTCAGTATGTTAAAGAAAACAAGGGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142362 Nonsense 181 336 4 7
ENSDART00000142362 Nonsense 181 336 4 7
Genomic Location (Zv9):
Chromosome 12 (position 17942676)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16753850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAACTTGGTGGACTGTTCCAGACCACAGGGCAATCAAGGGTGTAAC[G/T]GAGGCCTCATGGACCAGGCCTTTCAGTATGTTAAAGAAAACAAGGGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link