ENSDARG00000095708

Ensembl ID:
ENSDARG00000095708

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11718 Nonsense Available for shipment Available now
sa39019 Nonsense Mutation detected in F1 DNA During 2016
sa6361 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 323 771 1 3
Genomic Location (Zv9):
Chromosome 15 (position 891521)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 931824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGAGAAAAGCGTTATACCTGCCTACAGTGTGGAAAGAGTTTCTCYTG[G/A]AATCGTCACCTTGCCATCCATATGAGGATTCACACTGGAGAAAAGCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 408 771 1 3
Genomic Location (Zv9):
Chromosome 15 (position 891774)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 932077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTAAAGCCGTTCAATTGCCAACAGTGTGAAAAGAGTTTCACTTGT[A/T]AACAACACCTTACAGACCATGTGAGGATTCACACTGGAGAAAAGCCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137870 Nonsense 584 771 2 3
Genomic Location (Zv9):
Chromosome 15 (position 898519)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 938822
KASP Assay ID:
554-5352.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAACAGYRTGGAAAGAGTTTCAATCRGAGACAAAACTTAAAAGAACAT[G/T]AGAAGATTCACAATGGAGAAAAGCCTTACACTTGCCAACAGTGTGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link