ntrk2a

Ensembl ID:
ENSDARG00000095706
ZFIN ID:
ZDB-GENE-010126-1
Human Orthologue:
NTRK2
Human Description:
neurotrophic tyrosine kinase, receptor, type 2 [Source:HGNC Symbol;Acc:8032]
Mouse Orthologue:
Ntrk2
Mouse Description:
neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12452 Essential Splice Site Available for shipment Available now
sa41298 Nonsense Mutation detected in F1 DNA During 2017
sa30907 Nonsense Mutation detected in F1 DNA During 2017
sa34500 Nonsense Available for shipment Available now
sa27277 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140277 Essential Splice Site 64 375 None 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52039792)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49790179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCCCCAAGCTGGAGTCCGAGGCGGACATGGAGAACGTCACTGACATG[T/A]AAGTCATGCTGGGGGTCATATACACTGAAACAAAAGCGATACATTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140277 Nonsense 267 375 7 8
ENSDART00000140277 Nonsense 267 375 7 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52056607)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49806994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAAATGCAGAATCACCTGCAGATCGGATAACATGGTGGGAGAATCC[G/T]AGGCCTCTGTGGAGCTGGACATATTGTGTAAGTTATCAAGAGACACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140277 Nonsense 267 375 7 8
ENSDART00000140277 Nonsense 267 375 7 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52056607)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49806994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAAATGCAGAATCACCTGCAGATCGGATAACATGGTGGGAGAATCC[G/T]AGGCCTCTGTGGAGCTGGACATATTGTGTAAGTTATCAAGAGACACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140277 Nonsense 357 375 8 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52059439)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49809826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCCCACGCACATCAACAACGGCATGTACACGCTGCTGGCCAGAAAT[C/T]AATTCGGAGAGGACAGCAAGGCCGTATCTGCTCATTTCATGCATGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140277 Nonsense 363 375 8 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 52059457)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49809844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACGGCATGTACACGCTGCTGGCCAGAAATCAATTCGGAGAGGACAGC[A/T]AGGCCGTATCTGCTCATTTCATGCATGAGCCATGGAACGGTGAGTTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link