LOC100003058

Ensembl ID:
ENSDARG00000095701
Human Orthologue:
CARD14
Human Description:
caspase recruitment domain family, member 14 [Source:HGNC Symbol;Acc:16446]
Mouse Orthologue:
Card14
Mouse Description:
caspase recruitment domain family, member 14 Gene [Source:MGI Symbol;Acc:MGI:2386258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8228 Nonsense Mutation detected in F1 DNA During 2014
sa7037 Nonsense Mutation detected in F1 DNA During 2014
sa9829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131436 Nonsense 246 991 5 22
Genomic Location:
Chromosome 6 (position 19588349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCAATGCGACTTAAGGAAGGCACAGAAGCAGACAGAATTCCAGAGG[C/T]AGCATTCTGTGAAAAATTTAAGTGACACACAGAAGCTGAAAGATGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131436 Nonsense 571 991 14 22
Genomic Location:
Chromosome 6 (position 19579339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGYATCACTGGTCGCATACTCACCATATTTTTCCAAGGGGAAACSCTAT[T/A]GAACCAAATACAGATCATTGGTGGCAATAAGACTGGTGTGTTTGTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131436 Nonsense 671 991 16 22
Genomic Location:
Chromosome 6 (position 19577137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTACAACAACTAAAGAACGATGAAKTGATGTCGGGTGATTCGTTCTA[T/A]GTACGTGTTAACATGACATTGCCGGGGGATGTAGCAGGAAATCTGTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jk8dagrh