LOC100003058

Ensembl ID:
ENSDARG00000095701
Human Orthologue:
CARD14
Human Description:
caspase recruitment domain family, member 14 [Source:HGNC Symbol;Acc:16446]
Mouse Orthologue:
Card14
Mouse Description:
caspase recruitment domain family, member 14 Gene [Source:MGI Symbol;Acc:MGI:2386258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7037 Nonsense Mutation detected in F1 DNA During 2016
sa9829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131436 Nonsense 571 991 14 22
Genomic Location (Zv9):
Chromosome 6 (position 19579339)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21859732
KASP Assay ID:
554-5077.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGYATCACTGGTCGCATACTCACCATATTTTTCCAAGGGGAAACSCTAT[T/A]GAACCAAATACAGATCATTGGTGGCAATAAGACTGGTGTGTTTGTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131436 Nonsense 671 991 16 22
Genomic Location (Zv9):
Chromosome 6 (position 19577137)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21861934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTACAACAACTAAAGAACGATGAAKTGATGTCGGGTGATTCGTTCTA[T/A]GTACGTGTTAACATGACATTGCCGGGGGATGTAGCAGGAAATCTGTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link