wnk1

Ensembl ID:
ENSDARG00000095690
ZFIN ID:
ZDB-GENE-030131-2656
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WUP1]
Human Orthologue:
WNK1
Human Description:
WNK lysine deficient protein kinase 1 [Source:HGNC Symbol;Acc:14540]
Mouse Orthologue:
Wnk1
Mouse Description:
WNK lysine deficient protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2442092]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12971 Nonsense Available for shipment Available now
sa20204 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133434 Nonsense 207 477 4 8

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 4 (position 7275572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTGGCAGTTTCGACAAGGTAGCCATTCCAGAAGTKAAAGAGATCATC[G/T]AGGGATGTATTCGGCAAAACAAAGATGAAAGGTAACTACTGTWCACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133434 Nonsense 431 477 7 8

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 4 (position 7272261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCAGCTAAGCATGTCGTATAGTTCTCCTGGAACATCCCAACAACAG[C/T]AGGTCCCAGGACAGGGCACCTACACTCCCAGCTCTCAAGCTCCCCAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k7wznj4c