ftr36

Ensembl ID:
ENSDARG00000095678
ZFIN ID:
ZDB-GENE-070912-483
Description:
Novel protein similar to H.sapiens tripartite motif-containing [Source:UniProtKB/TrEMBL;Acc:B0S648]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1123 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1123
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133734 Nonsense 383 505 6 6
ENSDART00000137300 Nonsense 319 481 6 7
Genomic Location:
Chromosome 2 (position 60139128)
KASP Assay ID:
554-1034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAATTCATTGATATTTTTCCTGATTTTTATCTTCATCAGATTCTCAA[C/T]AGTTCACTTTGGATCCAAACACAGCGAATAACAGGCTGATTYTGTCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vxcpz637