si:ch211-241e1.2

Ensembl ID:
ENSDARG00000095614
ZFIN ID:
ZDB-GENE-070705-133
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, alpha 1E subunit (CACNA1E) [
Human Orthologue:
CACNA1E
Human Description:
calcium channel, voltage-dependent, R type, alpha 1E subunit [Source:HGNC Symbol;Acc:1392]
Mouse Orthologue:
Cacna1e
Mouse Description:
calcium channel, voltage-dependent, R type, alpha 1E subunit Gene [Source:MGI Symbol;Acc:MGI:106217]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8525 Nonsense Mutation detected in F1 DNA During 2017
sa1803 Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa8525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134656 Nonsense 332 939 8 24
Genomic Location (Zv9):
Chromosome 2 (position 1216225)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1162046
KASP Assay ID:
2259-1443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAGAGAGAGAGCGGGTGGAGAACAGACGTGCTTTCATGAAACTCAGA[C/T]GACAACAGCAGGTGGAGAGAGAACTGAACGGCTACCGGGCATGGATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1803
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134656 Splice Site None 939 None 24
Genomic Location (Zv9):
Chromosome 2 (position 1248735)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1194556
KASP Assay ID:
554-1795.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATACACTTTGGCATATAAGTATAAAATGCTAACAAACGTATGCTGTT[T/A]GATGCAGATGATTGACCAGGGCCTCATTCTTCACGATGGGTCGTATTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link