si:ch211-147h1.3

Ensembl ID:
ENSDARG00000095603
ZFIN ID:
ZDB-GENE-040724-161
Description:
Delphilin [Source:UniProtKB/Swiss-Prot;Acc:Q6ZM86]
Human Orthologue:
GRID2IP
Human Description:
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein [Source:HGNC Symbol;Acc:18464]
Mouse Orthologue:
Grid2ip
Mouse Description:
glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8696 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134944 Nonsense 597 1009 7 16
Genomic Location (Zv9):
Chromosome 12 (position 19664531)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18516692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCCCCAGCTTGACCAAACAGAAAAGCCTCCATTCCCAACCTTCTCAA[C/T]AAAGCTTTGAAGGCACACTGTCAAGCAAGGTTCCCCCTCCTCCACCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link