si:dkey-21e2.14

Ensembl ID:
ENSDARG00000095572
ZFIN ID:
ZDB-GENE-050208-699
Description:
Novel protein containing trypsin domains [Source:UniProtKB/TrEMBL;Acc:Q1LUR6]
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1215 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1215
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131487 Nonsense 188 260 4 5
ENSDART00000143589 Nonsense 179 199 4 4
Genomic Location (Zv9):
Chromosome 22 (position 19603231)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19259924
KASP Assay ID:
554-1124.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTAATGGAGGCAGAGACAGTTATAATGTATGATGCAGAGTGTGAACGC[A/T]GATGGGGATCTGATTATRTGGCCTCAAAGCTGATCTGTGTTTATGGCTAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link