taar18h

Ensembl ID:
ENSDARG00000095570
ZFIN ID:
ZDB-GENE-060413-2
Human Orthologues:
TAAR5, TAAR6, TAAR8
Human Descriptions:
trace amine associated receptor 5 [Source:HGNC Symbol;Acc:30236]
trace amine associated receptor 6 [Source:HGNC Symbol;Acc:20978]
trace amine associated receptor 8 [Source:HGNC Symbol;Acc:14964]
Mouse Orthologues:
Taar5, Taar6, Taar7a, Taar7b, Taar7d, Taar7e, Taar7f, Taar8a, Taar8b, Taar8c, Taar9
Mouse Descriptions:
trace amine-associated receptor 5 Gene [Source:MGI Symbol;Acc:MGI:2685073]
trace amine-associated receptor 6 Gene [Source:MGI Symbol;Acc:MGI:2685074]
trace amine-associated receptor 7A Gene [Source:MGI Symbol;Acc:MGI:2685075]
trace amine-associated receptor 7B Gene [Source:MGI Symbol;Acc:MGI:3527438]
trace amine-associated receptor 7D Gene [Source:MGI Symbol;Acc:MGI:3527443]
trace amine-associated receptor 7E Gene [Source:MGI Symbol;Acc:MGI:3527445]
trace amine-associated receptor 7F Gene [Source:MGI Symbol;Acc:MGI:3527447]
trace amine-associated receptor 8A Gene [Source:MGI Symbol;Acc:MGI:2685076]
trace amine-associated receptor 8B Gene [Source:MGI Symbol;Acc:MGI:2685995]
trace amine-associated receptor 8C Gene [Source:MGI Symbol;Acc:MGI:3527452]
trace amine-associated receptor 9 Gene [Source:MGI Symbol;Acc:MGI:3527454]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17297 Nonsense Available for shipment Available now
sa21804 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147757 Nonsense 157 342 1 1
Genomic Location:
Chromosome 10 (position 41928265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTAGCTRTGTGTCACCCTTTACTRTACCCACAGAAAATAACTWCAACT[A/T]AAACTTTAATAAGCATCTGTGTGTGCTGGTTTTGCAGTTCAGTTTACWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147757 Nonsense 285 342 1 1
Genomic Location:
Chromosome 10 (position 41928649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGTTTATCTGTTTTGCTGGATTCCTTTCTACATCTGTTCTCTAACA[A/T]AAATGACAGCAATCACTACTACTACAATGACATTTTTAACATGGACTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5yfz68wf