ogt.2

Ensembl ID:
ENSDARG00000095552
ZFIN ID:
ZDB-GENE-051128-1
Human Orthologue:
OGT
Human Description:
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylgluco
Mouse Orthologue:
Ogt
Mouse Description:
O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylgluco

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7388 Missense Mutation detected in F1 DNA During 2017
sa38988 Nonsense Mutation detected in F1 DNA During 2017
sa30674 Nonsense Mutation detected in F1 DNA During 2017
sa35673 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35672 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143891 Missense 108 1102 3 23
ENSDART00000148252 Missense 52 1046 2 22

The following transcripts of ENSDARG00000095552 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18603428)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14397881
KASP Assay ID:
554-4229.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTTGAGGCAGCAGAGCACCACTGTATGCAGCTGTGGAGGCAAGAGC[C/T]GGATAATACTGGTGTGCTGCTGCTGCTCTCCTCTATCCACTTCCAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143891 Nonsense 465 1102 11 23
ENSDART00000148252 Nonsense 409 1046 10 22

The following transcripts of ENSDARG00000095552 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18595865)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14390318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATTTGCGGATGCTTACTCCAACATGGGCAACACTCTGAAAGAGATG[C/T]AGGATATTCAGGGGGCACTGCGGTGCTACACTCGAGCCATTCAGATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143891 Nonsense 698 1102 16 23
ENSDART00000148252 Nonsense 642 1046 15 22

The following transcripts of ENSDARG00000095552 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18594095)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14388548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGGATCCATCAAGATGGAATCCACATCCTGGTCAACATGAACGGTTA[T/A]ACTAAAGGAGCACGCAATGAGCTGTTCGCATTGCGGCCAGCACCCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143891 Essential Splice Site 716 1102 17 23
ENSDART00000148252 Essential Splice Site 660 1046 16 22

The following transcripts of ENSDARG00000095552 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18593622)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14388075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATAAAAAGGGCTGGCTTAATATTAATTGTTTCTCACAATATTTTTA[G/T]GTCATGTGGCTTGGATACCCAGGCACCAGTGGAGCTCCATTTATGGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143891 Nonsense 895 1102 20 23
ENSDART00000148252 Nonsense 839 1046 19 22

The following transcripts of ENSDARG00000095552 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 18591105)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14385558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAACAATTGTGGTGACCACCCGCTCACAATATGGGCTTCCTGATGATT[C/A]AATTGTCTATTGCAACTTCAACCAGCTCTATAAGATTGACCCTCCAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link